ID: 984219213

View in Genome Browser
Species Human (GRCh38)
Location 4:176952895-176952917
Sequence CTATGTCAGTGGCAAATTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984219213_984219218 30 Left 984219213 4:176952895-176952917 CCTACAATTTGCCACTGACATAG No data
Right 984219218 4:176952948-176952970 AACACAATATTTTTCACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984219213 Original CRISPR CTATGTCAGTGGCAAATTGT AGG (reversed) Intergenic
No off target data available for this crispr