ID: 984219261

View in Genome Browser
Species Human (GRCh38)
Location 4:176953645-176953667
Sequence TTAATCAGTACAGTGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984219261_984219263 25 Left 984219261 4:176953645-176953667 CCACACTCCACTGTACTGATTAA No data
Right 984219263 4:176953693-176953715 ATTTCAATGTTCTAAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984219261 Original CRISPR TTAATCAGTACAGTGGAGTG TGG (reversed) Intergenic
No off target data available for this crispr