ID: 984219263

View in Genome Browser
Species Human (GRCh38)
Location 4:176953693-176953715
Sequence ATTTCAATGTTCTAAATACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984219262_984219263 18 Left 984219262 4:176953652-176953674 CCACTGTACTGATTAATTTAAAT No data
Right 984219263 4:176953693-176953715 ATTTCAATGTTCTAAATACAAGG No data
984219261_984219263 25 Left 984219261 4:176953645-176953667 CCACACTCCACTGTACTGATTAA No data
Right 984219263 4:176953693-176953715 ATTTCAATGTTCTAAATACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984219263 Original CRISPR ATTTCAATGTTCTAAATACA AGG Intergenic