ID: 984220941

View in Genome Browser
Species Human (GRCh38)
Location 4:176973619-176973641
Sequence GAGCAGCTGCATCACGGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984220935_984220941 4 Left 984220935 4:176973592-176973614 CCCACACACACACACACACCCAA No data
Right 984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG No data
984220932_984220941 7 Left 984220932 4:176973589-176973611 CCCCCCACACACACACACACACC 0: 12
1: 348
2: 6164
3: 10753
4: 16542
Right 984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG No data
984220933_984220941 6 Left 984220933 4:176973590-176973612 CCCCCACACACACACACACACCC No data
Right 984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG No data
984220936_984220941 3 Left 984220936 4:176973593-176973615 CCACACACACACACACACCCAAA No data
Right 984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG No data
984220934_984220941 5 Left 984220934 4:176973591-176973613 CCCCACACACACACACACACCCA 0: 12
1: 3990
2: 5874
3: 10076
4: 18567
Right 984220941 4:176973619-176973641 GAGCAGCTGCATCACGGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984220941 Original CRISPR GAGCAGCTGCATCACGGTGT GGG Intergenic
No off target data available for this crispr