ID: 984226663 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:177043653-177043675 |
| Sequence | CAGTGAAAGGAGAAGTGTTC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984226660_984226663 | -1 | Left | 984226660 | 4:177043631-177043653 | CCCTGATATGGTGGAGTAAGTGC | No data | ||
| Right | 984226663 | 4:177043653-177043675 | CAGTGAAAGGAGAAGTGTTCTGG | No data | ||||
| 984226661_984226663 | -2 | Left | 984226661 | 4:177043632-177043654 | CCTGATATGGTGGAGTAAGTGCA | No data | ||
| Right | 984226663 | 4:177043653-177043675 | CAGTGAAAGGAGAAGTGTTCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984226663 | Original CRISPR | CAGTGAAAGGAGAAGTGTTC TGG | Intergenic | ||
| No off target data available for this crispr | |||||