ID: 984226663

View in Genome Browser
Species Human (GRCh38)
Location 4:177043653-177043675
Sequence CAGTGAAAGGAGAAGTGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984226660_984226663 -1 Left 984226660 4:177043631-177043653 CCCTGATATGGTGGAGTAAGTGC No data
Right 984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG No data
984226661_984226663 -2 Left 984226661 4:177043632-177043654 CCTGATATGGTGGAGTAAGTGCA No data
Right 984226663 4:177043653-177043675 CAGTGAAAGGAGAAGTGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984226663 Original CRISPR CAGTGAAAGGAGAAGTGTTC TGG Intergenic
No off target data available for this crispr