ID: 984226982

View in Genome Browser
Species Human (GRCh38)
Location 4:177046889-177046911
Sequence TTCAATAAGGATGAGAAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984226980_984226982 -2 Left 984226980 4:177046868-177046890 CCACAGAAAAGGATGAATATCTT No data
Right 984226982 4:177046889-177046911 TTCAATAAGGATGAGAAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984226982 Original CRISPR TTCAATAAGGATGAGAAGAA AGG Intergenic
No off target data available for this crispr