ID: 984238617

View in Genome Browser
Species Human (GRCh38)
Location 4:177192169-177192191
Sequence AGGGAAGCTTCGGCCTGAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984238617_984238622 3 Left 984238617 4:177192169-177192191 CCGTCTCAGGCCGAAGCTTCCCT No data
Right 984238622 4:177192195-177192217 ATTAGGAGACAGAAGATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984238617 Original CRISPR AGGGAAGCTTCGGCCTGAGA CGG (reversed) Intergenic
No off target data available for this crispr