ID: 984239779

View in Genome Browser
Species Human (GRCh38)
Location 4:177204361-177204383
Sequence CTTATCTAAGTTCTGTTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984239779_984239784 26 Left 984239779 4:177204361-177204383 CCTGAAAACAGAACTTAGATAAG No data
Right 984239784 4:177204410-177204432 CCAAGGAGGTCCTTGAGCCCAGG No data
984239779_984239782 12 Left 984239779 4:177204361-177204383 CCTGAAAACAGAACTTAGATAAG No data
Right 984239782 4:177204396-177204418 TTAAAGTTATAAGACCAAGGAGG No data
984239779_984239781 9 Left 984239779 4:177204361-177204383 CCTGAAAACAGAACTTAGATAAG No data
Right 984239781 4:177204393-177204415 ACTTTAAAGTTATAAGACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984239779 Original CRISPR CTTATCTAAGTTCTGTTTTC AGG (reversed) Intergenic
No off target data available for this crispr