ID: 984240064

View in Genome Browser
Species Human (GRCh38)
Location 4:177207579-177207601
Sequence TAAGCAGCTCTTTCCTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984240064_984240068 22 Left 984240064 4:177207579-177207601 CCCTGTTAGGAAAGAGCTGCTTA No data
Right 984240068 4:177207624-177207646 TCAGCTTTTTACTCTAAAGTTGG No data
984240064_984240066 -8 Left 984240064 4:177207579-177207601 CCCTGTTAGGAAAGAGCTGCTTA No data
Right 984240066 4:177207594-177207616 GCTGCTTACATTTAAGAATGAGG No data
984240064_984240069 26 Left 984240064 4:177207579-177207601 CCCTGTTAGGAAAGAGCTGCTTA No data
Right 984240069 4:177207628-177207650 CTTTTTACTCTAAAGTTGGTTGG No data
984240064_984240067 -7 Left 984240064 4:177207579-177207601 CCCTGTTAGGAAAGAGCTGCTTA No data
Right 984240067 4:177207595-177207617 CTGCTTACATTTAAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984240064 Original CRISPR TAAGCAGCTCTTTCCTAACA GGG (reversed) Intergenic
No off target data available for this crispr