ID: 984240065

View in Genome Browser
Species Human (GRCh38)
Location 4:177207580-177207602
Sequence GTAAGCAGCTCTTTCCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984240065_984240069 25 Left 984240065 4:177207580-177207602 CCTGTTAGGAAAGAGCTGCTTAC No data
Right 984240069 4:177207628-177207650 CTTTTTACTCTAAAGTTGGTTGG No data
984240065_984240066 -9 Left 984240065 4:177207580-177207602 CCTGTTAGGAAAGAGCTGCTTAC No data
Right 984240066 4:177207594-177207616 GCTGCTTACATTTAAGAATGAGG No data
984240065_984240068 21 Left 984240065 4:177207580-177207602 CCTGTTAGGAAAGAGCTGCTTAC No data
Right 984240068 4:177207624-177207646 TCAGCTTTTTACTCTAAAGTTGG No data
984240065_984240067 -8 Left 984240065 4:177207580-177207602 CCTGTTAGGAAAGAGCTGCTTAC No data
Right 984240067 4:177207595-177207617 CTGCTTACATTTAAGAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984240065 Original CRISPR GTAAGCAGCTCTTTCCTAAC AGG (reversed) Intergenic
No off target data available for this crispr