ID: 984240068

View in Genome Browser
Species Human (GRCh38)
Location 4:177207624-177207646
Sequence TCAGCTTTTTACTCTAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984240064_984240068 22 Left 984240064 4:177207579-177207601 CCCTGTTAGGAAAGAGCTGCTTA No data
Right 984240068 4:177207624-177207646 TCAGCTTTTTACTCTAAAGTTGG No data
984240065_984240068 21 Left 984240065 4:177207580-177207602 CCTGTTAGGAAAGAGCTGCTTAC No data
Right 984240068 4:177207624-177207646 TCAGCTTTTTACTCTAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984240068 Original CRISPR TCAGCTTTTTACTCTAAAGT TGG Intergenic
No off target data available for this crispr