ID: 984246667

View in Genome Browser
Species Human (GRCh38)
Location 4:177283205-177283227
Sequence TCTTATCTTGAGAAGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984246667_984246670 -9 Left 984246667 4:177283205-177283227 CCAGCATCCTTCTCAAGATAAGA No data
Right 984246670 4:177283219-177283241 AAGATAAGACAGAGTCTTGTGGG No data
984246667_984246674 27 Left 984246667 4:177283205-177283227 CCAGCATCCTTCTCAAGATAAGA No data
Right 984246674 4:177283255-177283277 CCTATCCCTTTCTTTCTGCCTGG No data
984246667_984246671 -4 Left 984246667 4:177283205-177283227 CCAGCATCCTTCTCAAGATAAGA No data
Right 984246671 4:177283224-177283246 AAGACAGAGTCTTGTGGGAAAGG No data
984246667_984246669 -10 Left 984246667 4:177283205-177283227 CCAGCATCCTTCTCAAGATAAGA No data
Right 984246669 4:177283218-177283240 CAAGATAAGACAGAGTCTTGTGG No data
984246667_984246672 -3 Left 984246667 4:177283205-177283227 CCAGCATCCTTCTCAAGATAAGA No data
Right 984246672 4:177283225-177283247 AGACAGAGTCTTGTGGGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984246667 Original CRISPR TCTTATCTTGAGAAGGATGC TGG (reversed) Intergenic
No off target data available for this crispr