ID: 984247841

View in Genome Browser
Species Human (GRCh38)
Location 4:177296665-177296687
Sequence AGACCCTGCTTCAAAAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984247839_984247841 -3 Left 984247839 4:177296645-177296667 CCAGCCTGGGTGACAGAGTGAGA 0: 30388
1: 79844
2: 153170
3: 168549
4: 152343
Right 984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG No data
984247840_984247841 -7 Left 984247840 4:177296649-177296671 CCTGGGTGACAGAGTGAGACCCT 0: 6598
1: 26231
2: 68050
3: 126125
4: 184175
Right 984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG No data
984247835_984247841 18 Left 984247835 4:177296624-177296646 CCGAGATGGCGCCATTGCACTCC 0: 844
1: 14801
2: 78238
3: 154492
4: 140932
Right 984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG No data
984247838_984247841 7 Left 984247838 4:177296635-177296657 CCATTGCACTCCAGCCTGGGTGA 0: 14249
1: 108577
2: 215203
3: 218267
4: 141562
Right 984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984247841 Original CRISPR AGACCCTGCTTCAAAAAAAA AGG Intergenic
No off target data available for this crispr