ID: 984251735

View in Genome Browser
Species Human (GRCh38)
Location 4:177344163-177344185
Sequence TGTAGAAAACAGAATCAGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984251735_984251738 5 Left 984251735 4:177344163-177344185 CCGACCTGATTCTGTTTTCTACA 0: 1
1: 0
2: 2
3: 30
4: 350
Right 984251738 4:177344191-177344213 AGTCAGCTTAAGACTTTGTTTGG 0: 1
1: 0
2: 1
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984251735 Original CRISPR TGTAGAAAACAGAATCAGGT CGG (reversed) Intronic
900974672 1:6009518-6009540 GGGAGAGAACAGAATCAGGCTGG - Intronic
901121399 1:6897145-6897167 AGTAGAGAACAGGTTCAGGTAGG + Intronic
902774483 1:18666010-18666032 TGTAGAAAAAAGAAAGAGGCTGG + Intronic
903623008 1:24711751-24711773 TCTATAAAACAAAATCAGGCCGG + Intergenic
904302779 1:29566104-29566126 AGAACAAAACAAAATCAGGTGGG - Intergenic
904783534 1:32968241-32968263 AGAAGAAAACACAATCAAGTTGG - Intergenic
906048637 1:42852423-42852445 TGGGGAAAACAGAGGCAGGTTGG - Exonic
908986749 1:70032933-70032955 GGTAGAAAACAGAATTTAGTGGG - Intronic
909835245 1:80246155-80246177 GGTAGAAAACATAATCACCTTGG - Intergenic
911295311 1:96107536-96107558 TGTAGAAAACACATTCGAGTGGG - Intergenic
912445352 1:109731936-109731958 TATAGATAACAGAACCAGTTAGG + Intronic
912622942 1:111183436-111183458 TGAATAAAACAGAATAACGTAGG - Intronic
913229106 1:116726483-116726505 TGTGGAACTCAGAGTCAGGTAGG + Intergenic
914946035 1:152067056-152067078 TTTAGAAGTCAGAATCAGGAGGG + Intergenic
915947948 1:160167694-160167716 TGTAGACAGCAGAAGCTGGTTGG + Intronic
917068791 1:171126587-171126609 AAGAGAAAACAGAAACAGGTTGG + Intergenic
917847344 1:179031942-179031964 TGTAGAGAAGGGAAACAGGTTGG + Intronic
919235469 1:194836679-194836701 TGGAGATAACTGAATCATGTGGG + Intergenic
919263642 1:195233120-195233142 TGTTGAAAACAAAATTAGATAGG - Intergenic
919423271 1:197398527-197398549 TGTAGAAGAAAGAATCAGTAGGG + Intronic
919762902 1:201109557-201109579 TCCATAAAACAGAATGAGGTGGG + Intronic
920545466 1:206812893-206812915 TTTAGAAAACATATTCAGATGGG + Intronic
921539723 1:216398916-216398938 TTTAGAAAAGAGAATCAGAGTGG - Intronic
921669241 1:217908081-217908103 TATAGGAGACAGAATCAAGTGGG + Intergenic
921848616 1:219909984-219910006 TCTAGAAAACCAAATCAGGGCGG + Intronic
921881155 1:220255826-220255848 TGGAGAGAACAGAACCAAGTTGG + Intronic
922789479 1:228303278-228303300 GGAAGAAAACAGAAGCAGGAAGG - Intronic
923636855 1:235706777-235706799 TCTAGAAAAGAGAATAAGATAGG - Intronic
924796193 1:247294075-247294097 TGTAGAAACCAGAACCTGGAGGG + Intergenic
924830163 1:247585623-247585645 TGGAGAAAACAGAATGCTGTTGG + Intergenic
1064555531 10:16543500-16543522 TGAAGAAAACAAAAGCAGGGAGG + Intergenic
1065085159 10:22166557-22166579 TGCAGTAAACAGAATGAGCTTGG + Intergenic
1066227673 10:33400001-33400023 TGGAGAAATCAGAATAAGATTGG - Intergenic
1069257620 10:66353726-66353748 TGTAGAAAAAAAAATCAGGAAGG + Intronic
1069465167 10:68632026-68632048 AGTAGAAAACAGGATCTGGCCGG + Intronic
1069487515 10:68833648-68833670 TGTAGATAACATAACCAGTTAGG + Intronic
1070451530 10:76562878-76562900 TGTAGAAAACAGAGTTATTTTGG - Intergenic
1071879753 10:89883762-89883784 TCTGGAGAACAGAATCATGTGGG + Intergenic
1071905453 10:90169052-90169074 TATAGAAAAAAGTATCAGGGTGG - Intergenic
1074526917 10:114270692-114270714 AGTAGAGATCAGAATCGGGTTGG + Intronic
1074822750 10:117193601-117193623 TCTTGAAAACAGAATAAGGCAGG + Intergenic
1074848951 10:117423255-117423277 CTTAGAGAACAGAATCAGTTGGG - Intergenic
1075155402 10:119972497-119972519 TGTAGATAACACAAGCAGTTAGG - Intergenic
1075301988 10:121333106-121333128 TGTAGAAAAGAAGATCAGCTTGG + Intergenic
1077956452 11:7025625-7025647 TCTAGAAAACAGCATAGGGTTGG - Intronic
1078240866 11:9529889-9529911 GCTAGCAAACAGAACCAGGTGGG + Intergenic
1078671707 11:13371514-13371536 AGTAGAAAACAGAAGTAGGAAGG - Intronic
1079486608 11:20941712-20941734 TCTAGAAATCAGGATCAGATAGG - Intronic
1081538477 11:44013095-44013117 TGAAGGAAAGAGAATGAGGTAGG + Intergenic
1081565851 11:44260708-44260730 TGTAAAAAAAAAAATGAGGTCGG - Exonic
1081745961 11:45472756-45472778 TGTAAAAAACAAAAAGAGGTGGG + Intergenic
1081879803 11:46438980-46439002 AGTAAAACACAGAATCAGGCTGG + Intronic
1082109257 11:48256071-48256093 TGCACAGAACAGAAGCAGGTGGG + Intergenic
1082172693 11:49025231-49025253 TGTAAAAATCAGAATCAAATAGG - Intergenic
1083151447 11:60794231-60794253 TGTAGGGGACAGAAACAGGTTGG - Intronic
1083152288 11:60799396-60799418 TATAGAAAAAAGAATCAGTGTGG - Intronic
1083213236 11:61202503-61202525 TGGAGAAATCAGACCCAGGTGGG + Intergenic
1083216117 11:61221248-61221270 TGGAGAAATCAGACCCAGGTGGG + Intergenic
1083219001 11:61240074-61240096 TGGAGAAATCAGACCCAGGTGGG + Intergenic
1084402103 11:68950534-68950556 TGGAGAAGTCAGAGTCAGGTGGG + Intergenic
1085211821 11:74788004-74788026 TGTAAAAAATTGAATCAGCTAGG + Intronic
1085239401 11:75040072-75040094 TGTAGATAACACAAGCAGTTAGG - Intergenic
1085341741 11:75735940-75735962 TGTTGAAAAGGGAAACAGGTTGG - Intergenic
1086150401 11:83602930-83602952 TATAGAAAATAGAATCATGAAGG - Intronic
1086571664 11:88291836-88291858 TCTAGAAAAAAAAATCAGATGGG - Intergenic
1086601470 11:88639300-88639322 TGTAGAGCACAGAATCAGAGAGG - Intronic
1086693076 11:89810821-89810843 TGTAAAAATCAGAATCAAATAGG + Intergenic
1086712728 11:90028836-90028858 TGTAAAAATCAGAATCAAATAGG - Intergenic
1087045328 11:93839470-93839492 TGAAGAAAACAGATTCAGGGAGG - Intronic
1087219425 11:95530315-95530337 TCTAGGAAACAGACTCAAGTGGG + Intergenic
1088231927 11:107681892-107681914 TGGAGAAATCAGATTCAGGGAGG - Intergenic
1088436943 11:109824393-109824415 TATAGAAAACAGAATTAGAGAGG - Intergenic
1088845970 11:113668011-113668033 TGAAGAAAACAGAATGAGTCTGG - Intergenic
1089932986 11:122333186-122333208 AGTGAAAAACAGAATGAGGTGGG - Intergenic
1090590629 11:128263079-128263101 TGAAGAACACAGAACAAGGTAGG + Intergenic
1090945772 11:131428354-131428376 TGTAGAAAACTGGCCCAGGTTGG - Intronic
1091109488 11:132952561-132952583 GATAGAAAAGAGAAGCAGGTTGG - Intronic
1091136415 11:133194503-133194525 TGTAGAAAACTGAAGCAGCCGGG - Intronic
1092441302 12:8507641-8507663 TGTAGAAATCAGAATCTAGGTGG - Intergenic
1093838815 12:23870489-23870511 TGTAGAAAAAAGAATAGAGTTGG - Intronic
1096025592 12:48358402-48358424 TGGAGAAAACAGAACTAGGCTGG - Intergenic
1097003926 12:55901578-55901600 TGTTTAAAAGAAAATCAGGTGGG - Exonic
1097643349 12:62207558-62207580 TGTAGATAACAGAAACAAATGGG - Intronic
1099077518 12:78129314-78129336 TGTAGAAAATAGAAACAATTAGG + Intronic
1099790455 12:87327378-87327400 TGTAGACCACAAAAACAGGTGGG + Intergenic
1102627148 12:114244339-114244361 TGTAGAATAGAGAATCAAGAGGG + Intergenic
1103109331 12:118261445-118261467 TGTTAAATACAGAATCAGGAAGG + Intronic
1104379249 12:128292355-128292377 TGTCAAAAACAGGTTCAGGTGGG - Intronic
1105557827 13:21462674-21462696 TTTAGAAATCAGAAACTGGTCGG - Intergenic
1105880828 13:24605697-24605719 CGTAGAATACAGAATCTGGGTGG - Intergenic
1106925083 13:34605437-34605459 TTGAGAAAACAGAAGCAGGAAGG + Intergenic
1107676319 13:42801459-42801481 GATAGAGAACAGAACCAGGTGGG - Intergenic
1108144712 13:47464181-47464203 TGGGGAAAACAGAATCATTTGGG - Intergenic
1111087084 13:83390138-83390160 TTTAGAAAAAAGAATAAGATAGG - Intergenic
1111091887 13:83457599-83457621 TTTAGAAAAGACAATCAGATGGG - Intergenic
1111536681 13:89611100-89611122 TGGAGAAAACAGAATTATTTAGG - Intergenic
1111645183 13:91023349-91023371 TGCAGAACACAGACCCAGGTGGG - Intergenic
1112455739 13:99560974-99560996 TTTAAAAAACAAAATCAGCTGGG - Intronic
1112615070 13:100996340-100996362 TTTAAAAGACAGAATCAGATTGG + Intergenic
1112881539 13:104112103-104112125 TATAGAAACCAGTGTCAGGTAGG - Intergenic
1113048928 13:106187021-106187043 TGAAGGAAACAGAATTAAGTGGG + Intergenic
1113069303 13:106404653-106404675 TGTCTAAAACAGAATCACCTGGG - Intergenic
1113440999 13:110327753-110327775 TGACGAAAACAGAATTAGCTGGG - Intronic
1113827233 13:113265685-113265707 TTTATAAAACAGAAACAGGCAGG - Intronic
1115164811 14:30436284-30436306 GCTGGTAAACAGAATCAGGTGGG + Intergenic
1115647602 14:35380500-35380522 TGAAAAAAATATAATCAGGTTGG + Intergenic
1116666682 14:47785330-47785352 CGTAGAAAACAGAATGAGGAGGG - Intergenic
1116974360 14:51099291-51099313 TAAAGAAAAAAGAATCAGATTGG + Intergenic
1118819646 14:69336640-69336662 TGGAGAAAAATGAATCAGGCTGG - Intronic
1120549667 14:85854641-85854663 TGTTTAAAACATAATCAAGTTGG - Intergenic
1120860433 14:89250405-89250427 TTTAGAAAACAAAACCAGGCTGG - Intronic
1122241783 14:100373371-100373393 TGAAGAAAACAGACTAAGGTTGG - Intronic
1123805832 15:23872032-23872054 GGTAGAAAAGAAAATCAGGTTGG - Intergenic
1124038572 15:26079517-26079539 TGTACATAATGGAATCAGGTTGG - Intergenic
1125373335 15:39001325-39001347 TGAGGAGAACAGAATCAAGTTGG + Intergenic
1125405630 15:39350393-39350415 TGTAGAAATCAGAATCATGGAGG - Intergenic
1127052037 15:55094496-55094518 TGTAGAAAACTGAATAAGCAGGG - Intergenic
1127806371 15:62524709-62524731 TTTAGAATTCAGAATCAGTTGGG + Intronic
1128412282 15:67411482-67411504 TCTAGAAATCAGAACCATGTAGG + Intronic
1130292514 15:82615636-82615658 TAAAGAAAACAAAATCAAGTTGG + Intronic
1131373880 15:91907678-91907700 TGTAAAAAACAAAATTAGCTGGG - Intronic
1131820843 15:96272056-96272078 TGAAGTACACAGAATCATGTCGG + Intergenic
1132149579 15:99450075-99450097 GGTATAAAAAAGAATGAGGTTGG + Intergenic
1132630024 16:912767-912789 CAAAGAAAACAGAAGCAGGTGGG - Intronic
1133080555 16:3315699-3315721 TGTAGAAAACAGACTGTGGGAGG - Intronic
1135507225 16:23049492-23049514 TGGAGAAAACTGAATCATGGGGG + Intergenic
1135855843 16:26009311-26009333 TGTAGAAAGCAGAATCTATTGGG - Intronic
1136364237 16:29801685-29801707 TGGAGAATTCAGAATCAGGAAGG + Intronic
1137774903 16:51046361-51046383 TGAAGAAAAGGGAATGAGGTGGG + Intergenic
1139962290 16:70724944-70724966 TCTAGCAAACAGACTTAGGTTGG + Intronic
1140294758 16:73697919-73697941 TGTAGAAAACAAAATCTGGGTGG - Intergenic
1140607745 16:76561969-76561991 TGTTGAAGACAGAATGATGTGGG + Intronic
1141077130 16:81016900-81016922 AGTAGAGAGCAGAATGAGGTGGG + Intronic
1141090558 16:81127615-81127637 TGTAGGATACAGAATCATGCAGG - Intergenic
1142179537 16:88661073-88661095 TGTAAAAAAAAAAATCAGCTGGG - Intronic
1142661195 17:1430659-1430681 TTTAAAAATCAGAATCAGGCTGG - Intronic
1143557272 17:7669692-7669714 TGTAGGAGACAGAAGCAGGGAGG + Intronic
1143573374 17:7775368-7775390 TGTAGGAAGAAGAATCAGCTAGG - Intronic
1144465231 17:15491835-15491857 TACAGAAAACAGAAACAGCTAGG + Intronic
1145245738 17:21268255-21268277 TGAGGAAAACAGAATTAGGGAGG - Intergenic
1145354919 17:22134632-22134654 TGTTAAAAACAGTATCAGGCTGG + Intergenic
1145799589 17:27674357-27674379 TGTAGAACACAGAGGCAGGCCGG + Intergenic
1147164371 17:38585653-38585675 TTTAGAAAACAGACACAGATGGG - Intronic
1147285446 17:39399616-39399638 GGTAAAAAAAAGAATAAGGTGGG - Intronic
1149312591 17:55409369-55409391 TCTAGAAAACAGAATTAGAAAGG - Intronic
1149636370 17:58173311-58173333 GGTAGAAGAAAGAATCAGCTGGG - Intergenic
1150259781 17:63779557-63779579 AGAAGAAAACAAAATGAGGTGGG - Intronic
1150608333 17:66713344-66713366 TTTAGAAAGCACAATGAGGTCGG - Intronic
1150678165 17:67262806-67262828 TTTAGATAACAAAATCAGGTGGG - Intergenic
1153458879 18:5312110-5312132 TGTACAAAACATTAACAGGTTGG + Intergenic
1153582091 18:6583367-6583389 TGTAGAAGTCAGAATCTGGATGG + Intronic
1153873187 18:9339911-9339933 TCTAGTAAACAAAATCAGCTAGG + Intronic
1156322230 18:36037661-36037683 TGAAGAAAACAGAAAGATGTGGG + Intronic
1158212396 18:55066018-55066040 TTTAGAAAACAGTTTCAGCTGGG + Intergenic
1159294698 18:66469708-66469730 TGTAGAAAAAACAATCAAGAAGG - Intergenic
1160899919 19:1422489-1422511 TGTAGCAAACAGCCTCAGGAAGG + Intronic
1162679493 19:12329874-12329896 TCCAGAAAACAGAAGTAGGTAGG + Intronic
1164775059 19:30846504-30846526 TGAAGAGAACAGAATCAGGTTGG - Intergenic
1165780226 19:38428810-38428832 TTAAGAAAAAAGAGTCAGGTTGG - Intergenic
1166018254 19:40000326-40000348 AGTAGAAAACAGAATAAGGGTGG + Intronic
1167308685 19:48723608-48723630 ATGAGGAAACAGAATCAGGTAGG - Intronic
929327709 2:40637279-40637301 GGCAGAAAACAGAGCCAGGTGGG - Intergenic
929636716 2:43530088-43530110 TGGAGAAACAAGAATCAGATAGG + Intronic
929728294 2:44456824-44456846 TGTAGAAAACATAATTGGGCTGG - Intronic
930399323 2:50863008-50863030 TCTAGAGAACAGAATGAGGCAGG + Intronic
930493127 2:52102052-52102074 TGGAGATAACAGAATCATGGGGG - Intergenic
932517020 2:72361576-72361598 TGGAGAAAACAAAATTAAGTAGG + Intronic
933577263 2:84083353-84083375 TGCAGAAAACAGAATTGTGTTGG + Intergenic
934863062 2:97780445-97780467 TGTAGAAAACGGAGTGGGGTGGG - Intronic
935036489 2:99380346-99380368 AATACAAAACAGAATCAGGCTGG - Intronic
935300742 2:101691897-101691919 TATAAAAAACAGAATAAGCTGGG - Intergenic
935568650 2:104635939-104635961 TGTAGATAACAAAAGCAGGCTGG - Intergenic
935721029 2:105979397-105979419 TATAGATAACAGAACCAGTTAGG + Intergenic
936650852 2:114424033-114424055 TGTTGGAATCAGAATCAGGCTGG - Intergenic
937491189 2:122370316-122370338 TGGAGAAAAAGGAATGAGGTTGG + Intergenic
938009478 2:127817446-127817468 TGATGAAAACGGAATCAGGGAGG - Intergenic
938912999 2:135903177-135903199 TGTAGAACACAGAATAGTGTGGG - Intergenic
939096051 2:137834710-137834732 TGTAGAAAACTGAAAAAGGTAGG - Intergenic
940714117 2:157199225-157199247 TCTAGAAGACAGAAACAGGGGGG + Intergenic
941061939 2:160856747-160856769 AGTAGAAAACAGTATCTGGCAGG - Intergenic
941677139 2:168355895-168355917 TGTAGGAAATAGAACAAGGTGGG - Intergenic
941955000 2:171195205-171195227 TGTATAAAACATAATCCGGCCGG + Intronic
942507412 2:176657696-176657718 TATAGAACACAAAATCTGGTTGG + Intergenic
943066838 2:183096530-183096552 TGAAAAAAACAAAATGAGGTCGG - Exonic
943958026 2:194218226-194218248 TGGAGATAATTGAATCAGGTAGG - Intergenic
944103617 2:196055514-196055536 TGTAGAAACCAGAACCATTTGGG - Intronic
944431895 2:199643088-199643110 TTTAAAAAACAAAAACAGGTCGG - Intergenic
944518363 2:200536530-200536552 TTTAGAAAACAGTATAAAGTAGG - Intronic
945358066 2:208861972-208861994 TAGAGTAAACACAATCAGGTGGG + Intergenic
945782660 2:214195699-214195721 AGTAGAAAACAGAATCAGGAGGG + Intronic
945930538 2:215850549-215850571 AGTAGAAAACAGCAGCAGCTGGG + Intergenic
947252388 2:228122379-228122401 TATAGAGAACAGAACAAGGTTGG + Intronic
1169763463 20:9122380-9122402 TGTTTAAAACAAAATCACGTAGG - Intronic
1170191450 20:13649022-13649044 TGTAGAGAACAGCATTATGTAGG + Intergenic
1171468378 20:25349268-25349290 AGTATAAAAACGAATCAGGTAGG + Intronic
1171477072 20:25419106-25419128 TGTAGAATAAAGAATTTGGTGGG - Intronic
1171753516 20:29079318-29079340 AGTAGAAAACAGAAACCAGTTGG - Intergenic
1172266744 20:33622174-33622196 TTTGGAAAACAGCATGAGGTAGG + Intronic
1173285960 20:41671638-41671660 TGTAGAAAACAAAAGCAGCTTGG + Intergenic
1173722683 20:45273198-45273220 TGTAGAAAAAAGGAGAAGGTTGG - Intergenic
1173990415 20:47298095-47298117 TGAAGAAAACAAATTCAGGATGG - Intronic
1175473175 20:59248604-59248626 TGTAGAGAAAATAATCAGATTGG - Intronic
1176427849 21:6559796-6559818 TGTGGATAACAGGATCATGTGGG + Intergenic
1177133343 21:17283300-17283322 TGGAGAAAACAGAACCAAGTTGG + Intergenic
1177248255 21:18559060-18559082 AGTAGAAAACAGAAGAATGTTGG - Intergenic
1177698594 21:24607119-24607141 TATAAAAAAGAGAATCAGCTGGG + Intergenic
1178202907 21:30428040-30428062 TTTTGAAAAGAGAAGCAGGTAGG + Intergenic
1178704231 21:34859596-34859618 AGAACAAAACAGAATGAGGTTGG + Intronic
1179396971 21:41049383-41049405 TGTGGAGAAGAGAATCAGCTGGG - Intergenic
1179703341 21:43168113-43168135 TGTGGATAACAGGATCATGTGGG + Intergenic
1180013155 21:45064670-45064692 TCTAGAAAACAAAAATAGGTGGG + Intergenic
1181593900 22:23901859-23901881 TGATCAAAACAGAATCTGGTCGG - Intergenic
1182018618 22:27061983-27062005 AGCAGAGCACAGAATCAGGTTGG - Intergenic
1183974936 22:41506547-41506569 TATAAAAAACAGAATGAGGCCGG - Intronic
949723820 3:7021042-7021064 TATAGAAAACATAATCTGGCAGG - Intronic
949933565 3:9099415-9099437 TGAAGAAAACAGAATGAGGCTGG + Intronic
949974245 3:9440432-9440454 TGTAGAAAACAAATTCAGGGAGG - Intronic
950529091 3:13542665-13542687 TGTATAAAACAAAAGCAGTTGGG + Intergenic
950762051 3:15239553-15239575 TGTAGGAAACAGTATAAGATAGG + Intronic
952553428 3:34504642-34504664 TGGAGAACACAGAAGCAGGCAGG + Intergenic
952760363 3:36908215-36908237 TAAAGAAAACAGAAACAGGGTGG + Intronic
953824677 3:46240533-46240555 TTTAGAAAACAGGACCATGTGGG - Intronic
954491380 3:50909816-50909838 TGGAGAGAACAGAACTAGGTTGG - Intronic
956686860 3:71837368-71837390 TGGAGAAAACAAAATCTGATCGG - Intergenic
957541247 3:81572031-81572053 TGGAGATAACAGAATCATGGGGG + Intronic
958640367 3:96797685-96797707 TGGAGATAACTGGATCAGGTGGG - Intergenic
959220179 3:103508114-103508136 TTCAGAAATCAAAATCAGGTTGG + Intergenic
959472091 3:106764434-106764456 TGTGGGAAGCAGAAGCAGGTGGG + Intergenic
959596517 3:108134977-108134999 TTTAGTAAACAAATTCAGGTAGG + Intergenic
964086319 3:152822958-152822980 TGTAAAAAGTAGAATCAGGCAGG - Intergenic
964246478 3:154659780-154659802 TGTAGACAACAGATCCAGGCAGG + Intergenic
964955250 3:162347350-162347372 CATAAAGAACAGAATCAGGTTGG - Intergenic
965382606 3:168008537-168008559 TACAGAAAACAGAAGCAGGTGGG + Intergenic
966371938 3:179259955-179259977 TGCAGAGTACAGAAGCAGGTAGG - Intronic
967064648 3:185904044-185904066 AATAGAAAACAGAATCAGAGTGG - Intergenic
967471237 3:189864496-189864518 TGCAGAAGTCTGAATCAGGTAGG - Intronic
967704627 3:192635342-192635364 TTTTTAAAACACAATCAGGTTGG - Intronic
970183801 4:13428125-13428147 TGTAGATAACATAACCAGTTAGG + Intronic
970492537 4:16589369-16589391 TGTAGAAAATAGAAGCATGGTGG + Intronic
970739486 4:19217793-19217815 TGGAGAAAACTGAATCATGGGGG + Intergenic
972237367 4:37150058-37150080 GGAAGAAGACAGAATCTGGTTGG - Intergenic
973284662 4:48402375-48402397 TGGGGAGAACAGAATCAAGTTGG - Intronic
974576495 4:63730573-63730595 TTTAGAAAATAGAAGCAGATGGG - Intergenic
974730091 4:65852370-65852392 TTTTGAAAACAGGATCAGGTTGG + Intergenic
976018484 4:80590341-80590363 TTTAGAACACAGAATGAGCTGGG + Intronic
976294041 4:83451914-83451936 TGCAGAGAAGACAATCAGGTTGG - Intronic
976521645 4:86034880-86034902 TGTAGAAAACAGAATAGGGGTGG + Intronic
976725062 4:88207838-88207860 TGAAAAAAACAAAATGAGGTTGG - Intronic
977610349 4:99024098-99024120 TGTAGATAACATAACCAGTTAGG - Intronic
978965366 4:114734541-114734563 TGTAGAAAAAAGAAAAAGGAGGG + Intergenic
979406064 4:120311652-120311674 TGTAGAAAACTGATACAGTTTGG - Intergenic
979705177 4:123712281-123712303 GGTAAAAAACAAAATCAAGTTGG + Intergenic
980841911 4:138273104-138273126 TGTAGAAAACATATTCAGACAGG + Intergenic
982309437 4:153969195-153969217 TGTTGAAAAGAAAATCAGGCTGG + Intergenic
982861911 4:160463346-160463368 TGTATGAAACTGAACCAGGTGGG + Intergenic
983393777 4:167167920-167167942 TGGAGAAAACTGAATCATGGGGG + Intronic
983442690 4:167807494-167807516 TATAGAGATCAGAATGAGGTGGG + Intergenic
983637186 4:169909781-169909803 TGTAGATAACACAAGCAGTTAGG + Intergenic
984075065 4:175166714-175166736 GGTAGAAAACAGATTCAGGCTGG - Intergenic
984251735 4:177344163-177344185 TGTAGAAAACAGAATCAGGTCGG - Intronic
984470366 4:180163414-180163436 TGTAGTAAGCAGTATCAGCTTGG - Intergenic
986580258 5:9258434-9258456 TGGAGAAGACAGAATGAGATAGG - Intronic
987041057 5:14062750-14062772 TGTTGAAAAGACAATCACGTTGG - Intergenic
987483410 5:18490611-18490633 TGCAGCAAACTGAATAAGGTGGG + Intergenic
987745018 5:21959540-21959562 TGTAGAAAACAGAAAAAAGCAGG + Intronic
988276902 5:29092182-29092204 TGTAGATAACACAAGCAGTTAGG - Intergenic
988713428 5:33801268-33801290 TGTAGGAAACTGATACAGGTGGG + Intronic
989029512 5:37103962-37103984 TGGGGAGAACAGAATCAAGTTGG - Intergenic
989196618 5:38722960-38722982 TGCAGAAAACAGAAACAATTAGG + Intergenic
989426990 5:41307417-41307439 TGCAGAAAATAGAACCATGTTGG - Exonic
989534871 5:42551664-42551686 TGTAGGGATCAGAAGCAGGTAGG + Intronic
989699598 5:44246373-44246395 TGTAGTATACAGAATCACTTCGG - Intergenic
990460104 5:56023691-56023713 TGTAGAATCCAGAAAGAGGTGGG - Intergenic
990505631 5:56441467-56441489 TGAAGAAAACAGATGCAGGCAGG - Intergenic
990620947 5:57557775-57557797 TGTATAAAACAGACTCTTGTTGG - Intergenic
991557457 5:67911582-67911604 TGTAGCAAAGAGCATCAGGGTGG - Intergenic
991765225 5:69969670-69969692 TGTAGAAAACAGAAAAAAGCAGG + Intergenic
991782098 5:70148483-70148505 TGTAGAAAACAGAAAAAAGCAGG - Intergenic
991844459 5:70844741-70844763 TGTAGAAAACAGAAAAAAGCAGG + Intergenic
991874541 5:71148798-71148820 TGTAGAAAACAGAAAAAAGCAGG - Intergenic
993429566 5:87814794-87814816 TGTAGAATTCAGAATCTGGATGG + Intergenic
993637704 5:90365418-90365440 ATTAGAAAAAAGAGTCAGGTAGG + Intergenic
993709421 5:91209608-91209630 TCTACAAAACAGCCTCAGGTAGG - Intergenic
993788357 5:92173347-92173369 TGGAGAAAACATATTCAGTTTGG - Intergenic
994686704 5:102963655-102963677 TGTAGAAAACAGCACAATGTGGG + Intronic
995052379 5:107720776-107720798 TGGAGAGAACAGAACCAAGTTGG + Intergenic
995088360 5:108141708-108141730 TGAAGCAAACAGGTTCAGGTGGG - Intronic
995233535 5:109798986-109799008 TTTAAAAAACAGAATGAGGCTGG - Intronic
995502487 5:112823004-112823026 GGGAGGAAAGAGAATCAGGTAGG - Intronic
996711467 5:126547502-126547524 AGTAGAAAACAGAGGCAGGGAGG - Intronic
997396831 5:133567578-133567600 TGAAGAAAACATAAGCAGATGGG + Intronic
997728988 5:136150926-136150948 AGTAAAGAACAGAATCTGGTGGG + Intronic
997991626 5:138549359-138549381 TGTAGAAAAATGAAACAGGCTGG + Intergenic
998812311 5:145978621-145978643 TGTAGAAAACAAAACCAGGAAGG - Intronic
999000013 5:147910246-147910268 TGTAGAAAACTTAATCACATAGG - Intergenic
1000170621 5:158699937-158699959 TAGAGAACACAGAATCAGATAGG + Intronic
1001147796 5:169200042-169200064 TGATGAAGACAGACTCAGGTAGG - Intronic
1002493708 5:179597891-179597913 TGTAGAAAGCAGAATGAGGCCGG + Intronic
1003028824 6:2582504-2582526 TGCAGAAATGAGAATCAGATAGG + Intergenic
1004042450 6:11993889-11993911 GGGAGAAAACAGAAGCAGGAGGG + Intergenic
1004700931 6:18078873-18078895 TGGAGAAAACAGAAACAGGAAGG + Intergenic
1004899524 6:20181426-20181448 AGGAGAAAATAGAATCAAGTGGG - Intronic
1004981312 6:21027873-21027895 TCTGGAAAACAGAATCATTTGGG + Intronic
1005363219 6:25052472-25052494 AGTAGGAGGCAGAATCAGGTGGG - Intergenic
1008527551 6:52421099-52421121 TGGAGAAAAAAGAATGGGGTTGG - Intronic
1009529297 6:64789577-64789599 TGTCTAACACAGAATCAGGAAGG - Intronic
1009669761 6:66731771-66731793 TGGAGAAAACAGAATTAGATTGG - Intergenic
1009967814 6:70595272-70595294 TATAGAAGACAGAATCCAGTAGG + Intergenic
1010089576 6:71964783-71964805 TTAAGAAGAAAGAATCAGGTAGG + Intronic
1011002600 6:82607733-82607755 TTTAGGAAACAGACTCAGGGAGG + Intergenic
1011754142 6:90482194-90482216 TTAAGAAAACAGAAGCAGGAAGG - Intergenic
1012309536 6:97705408-97705430 TGTACAATACAAAATCAAGTAGG - Intergenic
1012849123 6:104425878-104425900 TGGAGAGATCAGAATCAGGTGGG - Intergenic
1013418547 6:109946060-109946082 AGTAGGAAAAAGACTCAGGTGGG + Intergenic
1013513381 6:110863664-110863686 TATAGAAAGCAGAATCAGGCCGG - Intronic
1015486755 6:133780104-133780126 TCTAGAAATCAGAGTCAGATGGG + Intergenic
1016137707 6:140566417-140566439 TAGAGAAAAGAGAATCAGGTAGG + Intergenic
1016139597 6:140592941-140592963 TGGAGAAAACTGAATCATGGCGG + Intergenic
1019255244 7:45701-45723 TGAAGAAAATAAAACCAGGTGGG + Intergenic
1020968597 7:14903981-14904003 AATAGAAGACAGAATCAAGTTGG - Intronic
1021848985 7:24789576-24789598 TATAGATAACAGAAGCAGTTAGG + Intergenic
1024318245 7:48041233-48041255 TGCAGACAACACCATCAGGTGGG - Intronic
1025033468 7:55575558-55575580 TGTAGAAAACAGACTAGGGCAGG + Intergenic
1025641488 7:63376321-63376343 TGGAGAAAACAGAAACATGCAGG + Intergenic
1026232529 7:68497686-68497708 TGGAGAAAACTGAATCGTGTGGG + Intergenic
1026264958 7:68788218-68788240 TATAGAAAACAAAATCTGGCTGG + Intergenic
1027516293 7:79146548-79146570 TGAAGATAACTGAATCATGTAGG + Intronic
1027960181 7:84936156-84936178 TGTATAAAACAGCCTCAGGCAGG - Intergenic
1028927819 7:96378874-96378896 TGGAAAAAATAGAATAAGGTAGG - Intergenic
1028929474 7:96397295-96397317 AGTAGAATACAGCACCAGGTAGG - Intergenic
1030907790 7:115207668-115207690 TGGAGATAACTGAATCATGTAGG - Intergenic
1030992304 7:116315072-116315094 CGTATAAAAGAGAATCAGGCTGG - Intronic
1031196135 7:118616363-118616385 TGTAAAAAATAAAATCAGGAGGG - Intergenic
1032888906 7:136172169-136172191 TGTAGAAAACAGATAAATGTGGG + Intergenic
1032919743 7:136532604-136532626 TGTAGAAATTGGAAACAGGTTGG + Intergenic
1034285464 7:149880751-149880773 TGGAGAAACAAGAATCAGGTGGG - Intergenic
1034521889 7:151626785-151626807 TGTATAAAAAAGACTCAGGGAGG - Intronic
1034718464 7:153265184-153265206 TGAAGAAAACAGAAAAATGTGGG - Intergenic
1035259677 7:157653466-157653488 TGTAGAAAGCACATGCAGGTTGG - Intronic
1035915295 8:3613984-3614006 TGTAGATAACAAAATCACCTAGG + Intronic
1038289716 8:26237929-26237951 CGTACAAAACAGAATCAGGAAGG - Intergenic
1040510138 8:48085872-48085894 TGGAGAAATCAGGGTCAGGTGGG + Intergenic
1041506955 8:58609578-58609600 TGTAGACCACAGGGTCAGGTGGG - Intronic
1043363052 8:79498399-79498421 TGGGGAAAACAGAATCAAGTTGG - Intergenic
1043454922 8:80403496-80403518 TGTAGAATTTAGAATCTGGTGGG + Intergenic
1043972479 8:86547128-86547150 TTTAGCAAAAAGAATCAAGTAGG + Intronic
1044916500 8:97117856-97117878 TGTAGAAATCAGAATGGGCTGGG - Intronic
1045662456 8:104452328-104452350 TGAAGAAAACAGAGACAGGAGGG + Intronic
1045876195 8:106983587-106983609 TGCAGAAAACAGAAGTGGGTTGG - Intergenic
1046191949 8:110807518-110807540 TGCAGAAAACAGAATGACATTGG - Intergenic
1046729290 8:117707908-117707930 GCTAGAAAACAGAATGGGGTTGG - Intergenic
1046902910 8:119541904-119541926 GGGTGAAAAGAGAATCAGGTTGG + Intergenic
1052084644 9:24249280-24249302 TGTAGCAGACAGAATCTGTTGGG + Intergenic
1052750998 9:32490623-32490645 TGTATAAAAGAGTATCAGGAAGG - Intronic
1052857349 9:33415544-33415566 TGCTGAAAACAGGATGAGGTTGG - Intergenic
1054822880 9:69541255-69541277 TATAGAAAACAGAATGGGGGGGG - Intronic
1055218831 9:73902652-73902674 TTTAGAAAATATAATCATGTAGG - Intergenic
1055222915 9:73959594-73959616 AGTAGAAAACAAACTTAGGTTGG - Intergenic
1055337808 9:75250948-75250970 TGTAGAAATCAGAATCTAGATGG - Intergenic
1055871944 9:80890999-80891021 TGTAGAAAACAAAATCATACAGG + Intergenic
1057912739 9:99033115-99033137 GGCAGAAAACAGACTCAGGCAGG - Intronic
1057951474 9:99372306-99372328 TATAGAAAAAAGATTCAGATGGG - Intergenic
1061076709 9:128345753-128345775 TTTTGAAAACAGTATGAGGTAGG - Intronic
1061097590 9:128468522-128468544 TCTAAAAAAAAAAATCAGGTGGG - Intronic
1061722454 9:132561110-132561132 GGTAGAACACAGATTCATGTAGG - Intronic
1061776097 9:132965587-132965609 TGTATAAGACAGAAGCAGGACGG + Intronic
1187200451 X:17129243-17129265 TGTGGAAAGCAGAATAAGGTGGG - Intronic
1187842509 X:23503716-23503738 TGTAGGAATCAGAATCAAATGGG + Intergenic
1187896752 X:23989155-23989177 TGTAGAAAACAAAAGAAAGTAGG - Intronic
1190990236 X:55541023-55541045 TGAAGAAAAGAGCATCAAGTAGG - Intergenic
1192404564 X:70871207-70871229 GGTATAAATCAGAATCAGGCTGG - Intronic
1194607755 X:96002747-96002769 GGTAGAAAACAGGTACAGGTGGG + Intergenic
1194962575 X:100252380-100252402 AATGGAAAACAGAAACAGGTAGG + Intergenic
1195279701 X:103319317-103319339 TTTAGGAAAGAGGATCAGGTTGG + Intergenic
1196381932 X:115099767-115099789 TGGGGAAAACAGAATTAAGTTGG + Intergenic
1196486072 X:116208756-116208778 TTTAAAAAACAGAACCAGCTAGG + Intergenic
1197552981 X:127917872-127917894 TATAGATAACACAAGCAGGTCGG - Intergenic
1197576822 X:128223495-128223517 TGGACACAACAGAACCAGGTTGG + Intergenic
1199108577 X:143902314-143902336 GGTAGAAAACACATTCAGTTGGG - Intergenic
1199147176 X:144381647-144381669 TGGAGATAACTGAATCATGTGGG + Intergenic
1199303677 X:146241836-146241858 TGGAGTAAACAGCATCAGGTAGG - Intergenic
1199920093 X:152392009-152392031 TTTAGAAAACAGAAACAGAAGGG + Intronic
1200343944 X:155429363-155429385 ATGAGGAAACAGAATCAGGTGGG - Intergenic