ID: 984253527

View in Genome Browser
Species Human (GRCh38)
Location 4:177363550-177363572
Sequence ACATAGAGAGTACATTAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984253525_984253527 27 Left 984253525 4:177363500-177363522 CCAGGAACTGGACTGGACAGTTG No data
Right 984253527 4:177363550-177363572 ACATAGAGAGTACATTAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984253527 Original CRISPR ACATAGAGAGTACATTAGGA AGG Intergenic
No off target data available for this crispr