ID: 984256534

View in Genome Browser
Species Human (GRCh38)
Location 4:177396053-177396075
Sequence GAGACGGAAGTTCCTACTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984256532_984256534 14 Left 984256532 4:177396016-177396038 CCTTAGGTAGTTGGTAAGACTGT No data
Right 984256534 4:177396053-177396075 GAGACGGAAGTTCCTACTCCTGG No data
984256530_984256534 16 Left 984256530 4:177396014-177396036 CCCCTTAGGTAGTTGGTAAGACT No data
Right 984256534 4:177396053-177396075 GAGACGGAAGTTCCTACTCCTGG No data
984256529_984256534 20 Left 984256529 4:177396010-177396032 CCTACCCCTTAGGTAGTTGGTAA No data
Right 984256534 4:177396053-177396075 GAGACGGAAGTTCCTACTCCTGG No data
984256531_984256534 15 Left 984256531 4:177396015-177396037 CCCTTAGGTAGTTGGTAAGACTG No data
Right 984256534 4:177396053-177396075 GAGACGGAAGTTCCTACTCCTGG No data
984256527_984256534 28 Left 984256527 4:177396002-177396024 CCGAAGTTCCTACCCCTTAGGTA No data
Right 984256534 4:177396053-177396075 GAGACGGAAGTTCCTACTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984256534 Original CRISPR GAGACGGAAGTTCCTACTCC TGG Intergenic
No off target data available for this crispr