ID: 984257101

View in Genome Browser
Species Human (GRCh38)
Location 4:177402093-177402115
Sequence CTGTTCACTAAACCTAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984257096_984257101 5 Left 984257096 4:177402065-177402087 CCTACTCAACCAATATGGTCACC No data
Right 984257101 4:177402093-177402115 CTGTTCACTAAACCTAAAGCAGG No data
984257097_984257101 -4 Left 984257097 4:177402074-177402096 CCAATATGGTCACCCTTTCCTGT No data
Right 984257101 4:177402093-177402115 CTGTTCACTAAACCTAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984257101 Original CRISPR CTGTTCACTAAACCTAAAGC AGG Intergenic
No off target data available for this crispr