ID: 984257778

View in Genome Browser
Species Human (GRCh38)
Location 4:177408296-177408318
Sequence CAGCAATCAGCAGTGGCGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984257771_984257778 23 Left 984257771 4:177408250-177408272 CCGGGCTGGATCTGGAGGGTGGA No data
Right 984257778 4:177408296-177408318 CAGCAATCAGCAGTGGCGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984257778 Original CRISPR CAGCAATCAGCAGTGGCGGA CGG Intergenic
No off target data available for this crispr