ID: 984260251

View in Genome Browser
Species Human (GRCh38)
Location 4:177436316-177436338
Sequence CAGCAATATGTCCTGTCTTA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984260249_984260251 -4 Left 984260249 4:177436297-177436319 CCATTTGTAGATGTACCAGCAGC 0: 1
1: 0
2: 0
3: 6
4: 112
Right 984260251 4:177436316-177436338 CAGCAATATGTCCTGTCTTATGG 0: 1
1: 0
2: 0
3: 13
4: 93
984260248_984260251 17 Left 984260248 4:177436276-177436298 CCATGTATTTTGAATTTTATACC 0: 1
1: 0
2: 2
3: 42
4: 422
Right 984260251 4:177436316-177436338 CAGCAATATGTCCTGTCTTATGG 0: 1
1: 0
2: 0
3: 13
4: 93
984260247_984260251 18 Left 984260247 4:177436275-177436297 CCCATGTATTTTGAATTTTATAC 0: 1
1: 0
2: 2
3: 67
4: 621
Right 984260251 4:177436316-177436338 CAGCAATATGTCCTGTCTTATGG 0: 1
1: 0
2: 0
3: 13
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984260251 Original CRISPR CAGCAATATGTCCTGTCTTA TGG Exonic
912799360 1:112711551-112711573 CATCAATAGTTCCTGCCTTAAGG - Intronic
921991722 1:221373767-221373789 CAGCAATATCCCCTCTCTTGTGG - Intergenic
923747156 1:236711972-236711994 AAGCCATATGTCCTTTCTTAAGG - Intronic
1065894527 10:30151752-30151774 CTGCAAAAAGTCCTGTCTTCAGG + Intergenic
1067776610 10:49168797-49168819 GAGCAGTATCTCCTGTCTTAAGG - Intronic
1068180672 10:53514212-53514234 CTGCAATATGTCCTTTCGTGTGG + Intergenic
1069796835 10:71059008-71059030 CAGGATTTTGTCCTGTGTTATGG - Intergenic
1071151082 10:82635449-82635471 CAGGAATATGTCCCTTCTTGGGG - Intronic
1074626290 10:115191370-115191392 CAGCATTATTGCCTGTCTTTTGG + Intronic
1075757506 10:124825441-124825463 AAGCAATAGTTCCTGACTTAAGG - Intronic
1079361628 11:19775274-19775296 CAGCAATATTTGCTGTCTCAAGG - Intronic
1079508404 11:21181560-21181582 TAGCAATATGTACTGATTTAAGG + Intronic
1079631703 11:22685235-22685257 CTGCATTATGTCCTGCCTTGTGG + Intronic
1079918658 11:26403239-26403261 AGGCATTATGTGCTGTCTTAGGG - Intronic
1080479427 11:32630946-32630968 TAGTAATATCTCTTGTCTTAAGG - Intronic
1083558455 11:63652115-63652137 CAGCAATATGATCTGTCTTTTGG + Intronic
1090517488 11:127444623-127444645 CAGCAATATAGAATGTCTTATGG - Intergenic
1090978267 11:131694354-131694376 CAGCACTGTATTCTGTCTTAGGG + Intronic
1091624825 12:2113841-2113863 CAAGCATATGTGCTGTCTTAGGG + Intronic
1092914564 12:13178375-13178397 CTGCCCTATGTCCTGTCTTAGGG - Intergenic
1095247168 12:39936497-39936519 CAGCTATATTTCCTGCCTTTAGG + Intronic
1095360354 12:41331236-41331258 CTGCATTAAGACCTGTCTTATGG + Intronic
1098199596 12:68040682-68040704 GAGAAAGATGTCCTGTCTGATGG + Intergenic
1099047359 12:77738017-77738039 CAAGAATATTTCCTGTCTTCAGG + Intergenic
1100674123 12:96847643-96847665 CTGCAATATATCCTGTCTCATGG + Intronic
1100911979 12:99374696-99374718 CAGCAATATAAGCTTTCTTATGG + Intronic
1102609111 12:114095714-114095736 CAGGAATACTTCCTGTCTTCAGG - Intergenic
1107975494 13:45684309-45684331 CAGCAATATTTGCTGGCTAAAGG - Intergenic
1108316367 13:49241357-49241379 CAGGAATATGTGCTTTGTTATGG - Intergenic
1111224807 13:85255355-85255377 CAGCAAGATTTCCTTTTTTAAGG - Intergenic
1113932893 13:113977597-113977619 CAGCAATGTGACCTGTCATCAGG + Intergenic
1118687032 14:68301535-68301557 CAGCAGAAAGTCCTGTCTTAGGG + Intronic
1118958827 14:70508671-70508693 CATTAATATGTCTTGTCTTTTGG - Intergenic
1123958915 15:25373335-25373357 CAGTAATATGGCCTGTCCTAGGG + Intronic
1125291506 15:38153322-38153344 CTGCAATATGTCTTGTTGTATGG - Intergenic
1127369031 15:58319200-58319222 CAGCAATATTTTATGTCTTCTGG - Intronic
1128953998 15:71920116-71920138 CAGAATTATTTCCTTTCTTAGGG + Intronic
1130952285 15:88602376-88602398 AAGAAAAATGTCCTGTGTTAAGG + Intergenic
1133853300 16:9526173-9526195 CACAAATATGTCCTTTATTATGG + Intergenic
1135735310 16:24926642-24926664 CAGCAAAGTGTCCAGGCTTATGG + Intronic
1141343305 16:83223323-83223345 CAGGAATAGGTGCTGTCTTTTGG - Intronic
1144464778 17:15488562-15488584 CAGCCAAGTGTCCTGTCTGATGG - Intronic
1146661870 17:34670259-34670281 CAGCAACATGCCCTGTCCTTTGG - Intergenic
1147669868 17:42170773-42170795 AACCAAAATGTCCTGTCCTAAGG - Intronic
1159021108 18:63143922-63143944 GAGCATGATGTCCTGCCTTAAGG - Intronic
1160323823 18:77921540-77921562 CAGAAATAGTTCCTGCCTTATGG - Intergenic
1164012766 19:21221479-21221501 CAGCAATATGATTTCTCTTATGG + Intronic
1165678946 19:37756485-37756507 CAGGCTTATGTGCTGTCTTATGG + Intronic
1167907187 19:52671458-52671480 CAGAACTAGGTCCTGTCTGAAGG - Intronic
925758799 2:7163598-7163620 CATCATCATGTCCTTTCTTAGGG - Intergenic
931986409 2:67746561-67746583 CATCAATATGTTCTGTAATATGG - Intergenic
936725440 2:115309430-115309452 TAGCAATATGTGGTATCTTAGGG + Intronic
939014705 2:136888806-136888828 CAGCAAAATGCCCTGTCCTCAGG - Intronic
939598046 2:144152315-144152337 CAGCACTCTGAACTGTCTTACGG + Intronic
945147855 2:206757730-206757752 ATGCAATATTTCCAGTCTTAGGG + Intronic
945518150 2:210788761-210788783 AAGCAATATGTTCATTCTTAGGG - Intergenic
945713876 2:213334291-213334313 CAGCATTATTACCTGTCTTTTGG - Intronic
1171451666 20:25240050-25240072 CAGAAACATGTCCTGACTTTGGG - Intergenic
1172052186 20:32126515-32126537 CAGCAATATACCCAGTCTTGGGG - Intronic
1173096586 20:40036147-40036169 AAGCAGTATCTCCTTTCTTAAGG - Intergenic
1175405667 20:58724774-58724796 CACCAATCTGTCTTCTCTTAGGG - Intergenic
1178018808 21:28385043-28385065 CATCAATATTTCCTCTCTTCTGG - Intergenic
1181460013 22:23080285-23080307 CAGCCACCTGTCCTGTCTTTTGG - Intronic
1181905689 22:26193969-26193991 GAGCAATGTGTCCTGTGATAGGG + Intronic
955726780 3:61941660-61941682 CAGCAAAATGTCATATTTTATGG - Intronic
957199060 3:77108641-77108663 CTGCAGTATGCCCTGTCTGAAGG - Intronic
961716386 3:128860343-128860365 CTGCATTTTGTCCTGTCTTGTGG - Intergenic
964222624 3:154364699-154364721 CAGCTCTATCTCCTGTCTTACGG + Intronic
970266237 4:14289912-14289934 AAGCAATTTGTTCTGTGTTAGGG + Intergenic
970370979 4:15406180-15406202 CAGAAAAATGTCCTGCCTTTAGG - Intronic
970450587 4:16163140-16163162 CAGTAATATGGCCTGGCTGAGGG - Exonic
970798299 4:19941691-19941713 CAGCACCATGTCCTGTCATCTGG + Intergenic
971835263 4:31755123-31755145 CAGCATGATGTACTGTCTCATGG + Intergenic
973235988 4:47905650-47905672 CAGCAAGATGTAAAGTCTTAAGG + Intronic
974809784 4:66931075-66931097 CATCAATATGTCCTGTCATTTGG + Intergenic
976547274 4:86350649-86350671 CAGAAGTATGGCATGTCTTAAGG + Intronic
976999833 4:91483351-91483373 GAAAAATATGTCCTCTCTTATGG + Intronic
977671280 4:99698503-99698525 CAGCAATGTGTCCAGTTTGATGG - Intergenic
979798016 4:124871439-124871461 CAGCATTTTGTTCTTTCTTATGG + Intergenic
983052395 4:163063760-163063782 TAGCAATATTTTCTGACTTATGG - Intergenic
984154516 4:176178260-176178282 CAACTATATGTCCTGTCTTTTGG - Intronic
984260251 4:177436316-177436338 CAGCAATATGTCCTGTCTTATGG + Exonic
987843294 5:23248840-23248862 CAGAAATTTGTCCTTTCTTAAGG + Intergenic
992358267 5:76008547-76008569 CAGCAAGATTTCCTGTAGTATGG - Intergenic
996651740 5:125885869-125885891 CAGCAGTATGTCCCTTTTTACGG + Intergenic
1004242925 6:13943953-13943975 CAACTATATTTCCTGTCCTAAGG - Intronic
1005784394 6:29228183-29228205 TAGCAATATGCCCTGATTTATGG + Intergenic
1007151532 6:39697329-39697351 AAGGACAATGTCCTGTCTTAAGG + Intronic
1007187492 6:39984667-39984689 CAGCAATATATGCTGTGTTCTGG - Intergenic
1009434379 6:63601277-63601299 CAGAGATAGATCCTGTCTTAAGG - Intergenic
1013385810 6:109629435-109629457 CAGTAAAATGGCCTTTCTTAGGG + Intronic
1016752371 6:147645156-147645178 CAGTAAGATGTCCTGTCGTGTGG - Intronic
1021173847 7:17427160-17427182 CAGCAATGTGTTGTCTCTTATGG + Intergenic
1027464462 7:78498303-78498325 GAGCAATAAGACATGTCTTAAGG - Intronic
1029625451 7:101717946-101717968 TAGCAATAGGCCCTGTCTTGGGG + Intergenic
1030775499 7:113529927-113529949 CAGCATTGTGTCCTGTTTTGGGG + Intergenic
1043506524 8:80908306-80908328 AATAAATGTGTCCTGTCTTAGGG - Intergenic
1048063262 8:130942576-130942598 CATCAAAATGTCCTCTGTTAAGG - Intronic
1049802742 8:144525752-144525774 CAGAAAGGTGTCCTGTCTTTGGG + Exonic
1189166513 X:38866414-38866436 CAGCAAAATGTCCAGTTCTAGGG + Intergenic
1189828300 X:44943192-44943214 CTGCAATATTTGCTTTCTTACGG - Intronic
1190879719 X:54483662-54483684 CACCTAGATGTCCTGTCTTCAGG + Intronic
1194524741 X:94965832-94965854 CAAGGATATGTCCTGTCGTATGG - Intergenic
1197703514 X:129617276-129617298 CAGCAAGAACTGCTGTCTTAGGG + Intergenic
1199136274 X:144256247-144256269 CAGGAAAATATCCTGTCCTACGG + Intergenic
1199331269 X:146562607-146562629 CAATAATTTGTCCTGTCTTAGGG + Intergenic
1201706160 Y:16939472-16939494 CTGCAAGATGTCCTGCCTTTTGG + Intergenic