ID: 984260333

View in Genome Browser
Species Human (GRCh38)
Location 4:177436937-177436959
Sequence ATCTGGCAAGGGCCATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 2, 1: 7, 2: 32, 3: 61, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984260333_984260338 6 Left 984260333 4:177436937-177436959 CCTTGGGATGGCCCTTGCCAGAT 0: 2
1: 7
2: 32
3: 61
4: 198
Right 984260338 4:177436966-177436988 GCCCTGTTCTTGAACTTCTCAGG 0: 1
1: 0
2: 2
3: 41
4: 266
984260333_984260341 22 Left 984260333 4:177436937-177436959 CCTTGGGATGGCCCTTGCCAGAT 0: 2
1: 7
2: 32
3: 61
4: 198
Right 984260341 4:177436982-177437004 TCTCAGGCTCCAGAACTGTGAGG 0: 2
1: 20
2: 116
3: 380
4: 940

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984260333 Original CRISPR ATCTGGCAAGGGCCATCCCA AGG (reversed) Intronic
903669485 1:25027093-25027115 ATCAGGCGAGGGGAATCCCAAGG + Intergenic
904061747 1:27716451-27716473 CTCTGGTGAGGGTCATCCCATGG - Intergenic
904329185 1:29746747-29746769 ATCTGCCCAGGGCCAGCCCTGGG - Intergenic
904418727 1:30378080-30378102 ATCTGGCTAACCCCATCCCATGG - Intergenic
904729751 1:32580812-32580834 ATCTGGCAAGGATCATCGGATGG + Intronic
905523392 1:38617472-38617494 ATCTGGCAAGGCTCATCTCATGG - Intergenic
905677620 1:39839207-39839229 ATCTGGCCATAGCAATCCCAAGG - Intergenic
905816516 1:40955012-40955034 ATCTGGCTAGGGTCATCCCAGGG + Intergenic
906525743 1:46492187-46492209 ATCTGGCAGAGCCCATCCCGAGG - Intergenic
907509932 1:54950453-54950475 ATCTGCCAAGGCTGATCCCAGGG - Intergenic
907890445 1:58631624-58631646 ATTTGGCAAGGGTCATCCCATGG - Intergenic
907890698 1:58633650-58633672 ATCTGGCAAGGGTCATCCCATGG - Intergenic
908606053 1:65797956-65797978 ATAATGCAAGGGGCATCCCAAGG - Intronic
909375357 1:74935100-74935122 ATCTAGCTAGGATCATCCCATGG - Intergenic
909589381 1:77328932-77328954 GTCTGGCAAGAGTCATCCCATGG + Intronic
910219424 1:84875550-84875572 ATCTGGCAAGGGCCATCCCATGG - Intronic
910263420 1:85313512-85313534 ATCTAACAAGGTTCATCCCATGG - Intergenic
911270436 1:95795219-95795241 ATCCAGCAAGGGTCATCCCATGG + Intergenic
911663719 1:100531741-100531763 ATCTGGCAAGGGCCTTCTGCCGG + Intergenic
913291183 1:117273799-117273821 ATCTGGCAAGGGTTATCCCATGG - Intergenic
914004478 1:143720616-143720638 ATCTGGCAGGGGAAATCCTATGG - Intergenic
915015692 1:152731081-152731103 ATCTGACAAGGGTCATCCCATGG - Intergenic
915852417 1:159339739-159339761 ATCTGACAAAGGTCAGCCCATGG + Intergenic
916748592 1:167703679-167703701 ATGTGGCAAAGCCCAGCCCATGG - Intronic
917511007 1:175669287-175669309 GCCTGGCAACGGCCTTCCCAGGG - Intronic
917593656 1:176504778-176504800 AAGTTGCAAGGGCCATCTCATGG + Intronic
917863373 1:179170113-179170135 ATCTGGTGAAGGTCATCCCATGG + Intronic
921383157 1:214545321-214545343 ATTTGGCCAGGGTCATCCTATGG + Intronic
921456284 1:215376021-215376043 ACCTGGAAAGGGTCATGCCATGG + Intergenic
922723058 1:227908620-227908642 AACTGGCCAGGACCAGCCCACGG - Intergenic
923474169 1:234317269-234317291 AGCTGGCAAGTGCTTTCCCATGG - Intronic
1062880223 10:972355-972377 ATCTGGTGAGGGCCTTCCCCTGG - Intergenic
1065644960 10:27824466-27824488 ATCTGTCAAGGGTCATTCCATGG - Intronic
1068145746 10:53068076-53068098 GTCTGCTAAGGGTCATCCCATGG - Intergenic
1068496278 10:57788833-57788855 TTCTGGCCAGGGCCACCCCCAGG + Intergenic
1071036652 10:81255628-81255650 ATCTGGTGAGGGTCATCTCATGG + Intergenic
1071079856 10:81798147-81798169 ATCTGGCAAGGGTTATGCCATGG - Intergenic
1072018692 10:91377141-91377163 ATCTGGCAACAGTCATCTCATGG - Intergenic
1072436579 10:95419581-95419603 ATCAGGCATGAGCCTTCCCAGGG + Intronic
1074549125 10:114426947-114426969 ATCTGAGAAGGGCAAACCCAAGG - Intergenic
1074969736 10:118526239-118526261 ATCAGGCAAGGGTCATCCCATGG - Intergenic
1075674431 10:124286529-124286551 ATCTGTGAGGGGCCACCCCAGGG - Intergenic
1076435178 10:130435883-130435905 CTCTGGCAAGGGTTGTCCCATGG + Intergenic
1077028285 11:451391-451413 ATCGGCAAAGGGCCAGCCCAGGG - Intronic
1079892095 11:26068606-26068628 ATCTGACAAGGGTCATCCCATGG - Intergenic
1079979324 11:27132371-27132393 ACCTGGTAAGAGCCATCCAAGGG + Intergenic
1081305965 11:41512676-41512698 ATCTGGCTGGTGCCATCCCATGG - Intergenic
1082065564 11:47896668-47896690 ATCTGGTGAGGGTTATCCCATGG + Intergenic
1082631540 11:55548174-55548196 ATGTGTCAAGTGCCATCCTATGG - Intergenic
1083170036 11:60918371-60918393 ATCTGGCAAGGGTCATCCTATGG + Intronic
1083204184 11:61138169-61138191 ATCTCACAGGGGACATCCCAGGG + Intronic
1083916235 11:65745304-65745326 ACCTGCCAAGGGCCAAGCCAAGG - Intergenic
1084179001 11:67437368-67437390 ACCAGGTAAGGGCCTTCCCAGGG + Intronic
1084491601 11:69481592-69481614 CTGTGACAAGTGCCATCCCATGG + Intergenic
1084744759 11:71162277-71162299 ATGTGGCAAAGGGCATCACATGG + Intronic
1086191404 11:84083686-84083708 ATCTGACAAAGGCCATCCCTTGG - Intronic
1086287186 11:85263547-85263569 AACTGGCCAGGGCCATTCCCTGG - Intronic
1086593550 11:88544124-88544146 ATCTGGGGAGGGTCATCCCATGG - Intronic
1091999838 12:5023003-5023025 ATATAGCAAGGGTCATCCAACGG + Intergenic
1092646424 12:10578940-10578962 ATCTGGCAAGGGTCATCCCATGG - Intergenic
1096363016 12:51004500-51004522 ATCTAGCAATGCCCAGCCCAAGG - Intronic
1096560651 12:52433738-52433760 CTCTTGGAAGGGCCATCCCATGG - Intronic
1098103320 12:67042151-67042173 ATCTGGTGAGAGTCATCCCACGG - Intergenic
1098318674 12:69218118-69218140 ATCTGGCAAGGGTCATCCCATGG - Intergenic
1099005144 12:77226774-77226796 AGCTCACAAGGGCCATCTCAGGG - Intergenic
1099093688 12:78344570-78344592 ATCTGGCAACAGACATCTCAAGG + Intergenic
1099921185 12:88959075-88959097 ATGTGGGAAGGGCCTTTCCATGG - Intergenic
1101752865 12:107597403-107597425 ATCTGGTGAGAGTCATCCCACGG + Intronic
1101833137 12:108274835-108274857 ATCTGGCATGGGCCATCCCATGG - Intergenic
1104581819 12:130016350-130016372 ATCCGCCAAGGTCCATCCCCTGG - Intergenic
1105624550 13:22100303-22100325 ATCTGGCAAGAGTCATCCTACGG - Intergenic
1111093537 13:83478550-83478572 AACTGGTAAGGGCAATTCCATGG + Intergenic
1111811809 13:93100564-93100586 ATCTGGTGAGGGTCATCTCACGG - Intergenic
1114726292 14:24941294-24941316 ATGTGGCAAGGGCCATGATAGGG + Intronic
1115840953 14:37469823-37469845 ATCTGGTGAGGGTCATCCCATGG - Intronic
1116439667 14:44937760-44937782 ATCTGGGAAGGGTCATCTCATGG + Intronic
1117030456 14:51663826-51663848 ATCTGGCCCAGGTCATCCCATGG + Intronic
1117651892 14:57916116-57916138 AGCGGGCAAGGGTCGTCCCATGG + Intronic
1119556487 14:75557395-75557417 ATCTGGCCAGGGTCATCCCATGG + Intergenic
1119556613 14:75558303-75558325 ATCTGGCAAGTGTTATCCCATGG + Intergenic
1121491200 14:94362246-94362268 ACCTGACAAGTGCCATCCAAGGG + Intergenic
1121820505 14:96962050-96962072 ATCCAGCAAGGGTCATCCTATGG - Intergenic
1122022232 14:98847743-98847765 TTCTGCCAAGGGCCACCCCCTGG - Intergenic
1122837756 14:104438346-104438368 CCCTGGCATGGGCCATCCCATGG + Intergenic
1124593079 15:31070378-31070400 ATCTGGAAAAGGCCATCAGATGG - Intronic
1125066395 15:35490909-35490931 ATCTGGTGAGGGTCATCTCATGG + Intronic
1125175049 15:36811505-36811527 AACTGGCAAAGGCCAACGCAGGG - Intergenic
1126786620 15:52182273-52182295 TTCTCACAAGGGCCATCTCAGGG + Intronic
1128550163 15:68593016-68593038 ATCTGGTGAGGGTCATCCCATGG + Intronic
1129118591 15:73380884-73380906 ATCTGGTAAGGGTCATCCTGTGG + Intergenic
1130032974 15:80332674-80332696 TTCTGGCAATGGCCACTCCAGGG + Intergenic
1131099196 15:89674699-89674721 ATATGTGAAGGGCCAACCCATGG - Intronic
1131280015 15:91013574-91013596 ATCTGGCGAGGGTCATCCCATGG - Intronic
1131755571 15:95557295-95557317 AGCTGGCAAGGGGCTTCCCGGGG - Intergenic
1132335281 15:101044466-101044488 AGCTGGGAAAGGCCGTCCCAGGG - Intronic
1137666061 16:50249774-50249796 ATCTGGCCAGGGCCATTGCCAGG + Intronic
1137898605 16:52240182-52240204 ATCTGGTGAGGGTCTTCCCATGG - Intergenic
1138793134 16:59932642-59932664 ATCTGGTGAGGGTCATTCCATGG - Intergenic
1139497487 16:67331007-67331029 ATCTGGTGAGGGTCATTCCATGG + Intronic
1140959239 16:79896535-79896557 ATCTTGCAAGCTACATCCCAAGG - Intergenic
1142572632 17:884979-885001 ATCTGGCCTGGGGCATCCTATGG + Intronic
1144180415 17:12746360-12746382 ATCTGGCAAATGCCATCCCATGG + Intronic
1144645751 17:16972331-16972353 ATCTGGCCTTGGCCATCCCTTGG + Intergenic
1147438844 17:40434830-40434852 ATCTGGCAAGGGTCCTCCCATGG + Intergenic
1149436708 17:56639545-56639567 ATCTGGAAATGGCTTTCCCAAGG + Intergenic
1149691275 17:58578821-58578843 CTCTGGCAGGGGCCTTCACAAGG + Intronic
1151072625 17:71233339-71233361 ATATGGCCAAGGTCATCCCATGG - Intergenic
1151520480 17:74625565-74625587 ATCTGACAAGCGTCATTCCATGG + Intergenic
1153447172 18:5187467-5187489 ATCTGGTGAGGATCATCCCATGG + Intronic
1153447500 18:5190056-5190078 ATTTGGCAAGGGTCACCCCATGG + Intronic
1153602582 18:6795863-6795885 ATATGGCCTGGGACATCCCAAGG + Intronic
1154256189 18:12782555-12782577 GTCTGGCAAGGGTCAGCTCAGGG + Intergenic
1154936479 18:21063060-21063082 ATCTGGCAAGGGTCATTCAATGG + Intronic
1155965387 18:32030782-32030804 ACCTGGCTAGGGTCATCCCCTGG + Intronic
1156646710 18:39171641-39171663 ATCTGGTGAGGGTCATCTCATGG + Intergenic
1157781493 18:50443897-50443919 ATCTGGTGAGGGTCATCCCATGG + Intergenic
1160504889 18:79421462-79421484 GCCGGGCAAGGGCCACCCCAGGG + Intronic
1160631045 18:80246847-80246869 CCTTGGCCAGGGCCATCCCACGG + Intronic
1162306523 19:9877759-9877781 CTCTGGCAAAGGTTATCCCATGG - Intronic
1164643529 19:29843134-29843156 ATGTGGCCAGGGCCACCCCAGGG - Intergenic
925768232 2:7258576-7258598 ATCTGGCAGATGCCATCACAGGG - Intergenic
927084185 2:19658165-19658187 ATCTGGTGAGGGTCATCCCATGG + Intergenic
927359932 2:22221358-22221380 ATCTGGTGAGGGTCATCCTATGG + Intergenic
929542970 2:42836486-42836508 ATCTGGCTAGGGCGATTTCAAGG + Intergenic
929617254 2:43321629-43321651 ATCTGGTGAGGGTCATCCCATGG - Intronic
930187589 2:48425895-48425917 ATCTGGGAAAGGCCAGGCCAAGG + Intergenic
930876319 2:56221908-56221930 ATCTGGCAAGGGTCATTCCATGG + Intronic
931381045 2:61753704-61753726 ATCTGACAAGGGTCATCCCATGG + Intergenic
931534863 2:63263499-63263521 ATCTGGTAAGAGTGATCCCATGG - Intronic
931937813 2:67217585-67217607 TTCTGGGAAGGGTCATCCTAAGG - Intergenic
932206259 2:69885600-69885622 ATCTGGTGAGGGTCATCTCATGG - Intergenic
933976533 2:87516449-87516471 ATCTACCAAGGGCCAACCCTTGG + Intergenic
934942469 2:98512519-98512541 ATCTGGTGAGGGTCTTCCCATGG + Intronic
936059945 2:109287993-109288015 CCCTGGCATGGGCCATCCCATGG + Intronic
936317286 2:111434356-111434378 ATCTACCAAGGGCCAACCCTTGG - Intergenic
937772560 2:125737384-125737406 ATCTGGCAAGAGACTTCTCAGGG + Intergenic
937992318 2:127671538-127671560 AACTGGCAAGGGACAGCCCAGGG - Intronic
938816515 2:134910046-134910068 ATCTGGCAATGTCCATACCAGGG + Intergenic
940058683 2:149540688-149540710 ATCAGGCAAGAGCCATACCATGG - Intergenic
940307367 2:152240725-152240747 ATCTCGCAAGGGTCATCCCAGGG - Intergenic
940624737 2:156159603-156159625 ATCTGGGAAGGGCAATTTCAGGG + Intergenic
940667077 2:156621796-156621818 ATCTGGTGAGAGCCATCCCATGG - Intergenic
940852859 2:158704720-158704742 ATCTGACAAAGGCCCTCCCTGGG - Intergenic
941685951 2:168448939-168448961 ATCTGGTGAGGGTCATCGCATGG - Intergenic
943036971 2:182759254-182759276 TTCTGGCAAGGTCCACACCAAGG - Exonic
943129157 2:183836225-183836247 ATCTGGTGAGCGTCATCCCATGG + Intergenic
944184571 2:196932714-196932736 ATCTGGAGAGGGTCATCCTATGG - Intergenic
945511587 2:210709644-210709666 ATCTGGTGAGGGTCATCCTATGG + Intergenic
945749293 2:213760830-213760852 ATTTGGCAAGGGACATCCTATGG + Intronic
947540597 2:230974860-230974882 ATCTAGTGAGGGCCATCCCATGG + Intergenic
948412438 2:237774556-237774578 ATCTGACAATGACCAGCCCAGGG - Intronic
948547449 2:238742957-238742979 ATCAGGTAAGGGCTATGCCAGGG + Intergenic
949044030 2:241862425-241862447 ATCTGGCTGCTGCCATCCCAGGG - Intergenic
1169826824 20:9777749-9777771 ATCTAGCATGGGCTATGCCAGGG + Intronic
1170828947 20:19823142-19823164 ACCAGGGAAGGGCCATCCCAGGG - Intergenic
1170829341 20:19826424-19826446 AACAGGGAAGGGCCACCCCAGGG - Intergenic
1170842091 20:19932273-19932295 ATCTGGTAAGAGTCATCCCGTGG - Intronic
1171143898 20:22765273-22765295 CTCTGGCAAAGCCCACCCCATGG - Intergenic
1172318619 20:33977751-33977773 ATCTGGTGAGGGTCTTCCCATGG + Intergenic
1174217742 20:48930160-48930182 ATCTGGCCAGGGTCATCCTATGG + Intronic
1175925417 20:62468924-62468946 GTGTGGCAGGGGGCATCCCAGGG - Intronic
1175928045 20:62480503-62480525 TTCTGGGAAGGGCCCTCCCTGGG - Intergenic
1176665685 21:9685423-9685445 ATCTGACAAGCCCCTTCCCAGGG - Intergenic
1176997077 21:15567940-15567962 ATCTGGTGAGGGACATCCCATGG + Intergenic
1177866466 21:26518501-26518523 ATCTGGCAAGGGTCATCCCAAGG - Intronic
1178095210 21:29207609-29207631 ATCTGGTGAGTGGCATCCCATGG + Intronic
1178666102 21:34547779-34547801 ATCTGGTGAGGGTCATCGCATGG - Intronic
1182160151 22:28113406-28113428 AACTGGAAAAGGCCCTCCCATGG + Intronic
1184155309 22:42662906-42662928 ACATGGCAGGGCCCATCCCAGGG + Intergenic
1184564820 22:45285578-45285600 CTCTGGCTATGGCCCTCCCATGG - Intronic
1185133390 22:49053415-49053437 ATCTGGCAAAGGTCATCCCATGG - Intergenic
949917950 3:8979434-8979456 ATCTGGCTAGGGCCATCTCATGG - Intergenic
950409253 3:12824383-12824405 ATCTGGTGAGGGCCATCCCATGG + Intronic
950930896 3:16788003-16788025 ATCTGGTGAGGGTCATCCCATGG + Intergenic
953532663 3:43752497-43752519 AGCTGGCAAGGTCCATCTCCAGG + Intergenic
954920267 3:54184609-54184631 ATGTGAAATGGGCCATCCCATGG + Intronic
955514524 3:59713605-59713627 ATCTGGTGAGGGTCATCCCTTGG + Intergenic
956294083 3:67693194-67693216 ATCTGGTAAGAGTCATCCCATGG + Intergenic
956586585 3:70871658-70871680 GTCAGGCAAGGGTCATCCCATGG - Intergenic
959090302 3:101895525-101895547 GTCTGGTAAGGGTCATCTCATGG - Intergenic
960156366 3:114300696-114300718 ATTTGGCGAGGTTCATCCCACGG + Intronic
960984923 3:123271675-123271697 ATCTGGCTAAGGCAAGCCCAGGG + Exonic
962282481 3:134062480-134062502 ATCTGGTGAGGGGCATCCCATGG + Intergenic
962352677 3:134667126-134667148 ATCTGGGAAGAGGCATACCATGG - Intronic
962738077 3:138343633-138343655 ATCTGGTGAGGGCCCTCCCATGG + Intergenic
963045379 3:141098920-141098942 ATCCGGCGAGGGTCATCCCATGG + Intronic
965441460 3:168720451-168720473 ATCTGGCAATGGTCATCCCATGG + Intergenic
966051089 3:175618451-175618473 AGCTGCAAAGGGCAATCCCAAGG - Intronic
967240862 3:187438276-187438298 ATCTGGTGAGGGTCATCCCATGG + Intergenic
968536006 4:1130073-1130095 ATCTGGCAAGGGTCAGCCCACGG - Intergenic
968615395 4:1575443-1575465 GTCTGGCAGGGGCCACACCAGGG + Intergenic
969638884 4:8385045-8385067 ACCTGGCAGGGGCCAGGCCATGG - Intronic
970274729 4:14386132-14386154 ATCTGGCAACGGCGATCCCACGG + Intergenic
971366667 4:25983221-25983243 ATCTGGCGAGGGCCACCCCATGG + Intergenic
971981541 4:33757719-33757741 ATCTGGAGAGGGTCATCCCATGG + Intergenic
972224833 4:37000780-37000802 ATCTGGCAAGGCCCCTGACAAGG - Intergenic
972538290 4:40017408-40017430 AGCTGGCAAAGCCCAGCCCATGG + Intergenic
974087047 4:57272802-57272824 ATCTGGCAAGGGCAATCCCATGG - Intergenic
974493275 4:62594471-62594493 ATCTGGTGAGGGTCATTCCACGG + Intergenic
975859917 4:78665808-78665830 ATCTGGCAGGAGTCATTCCATGG - Intergenic
976104694 4:81604186-81604208 ATCTGGTGAGGGCCCTCCCATGG - Intronic
976286763 4:83378145-83378167 GGCTGGCAAGAACCATCCCATGG - Intergenic
977130128 4:93225882-93225904 ATCTGGAGAGGGTCATCTCATGG + Intronic
977244753 4:94618167-94618189 AGCTGGCAACGGCCAAACCAAGG + Exonic
977554608 4:98476125-98476147 TCCTGGCAAGGGCTCTCCCAGGG + Intronic
977675937 4:99747088-99747110 ATCTGGTGAGGGTTATCCCATGG + Intergenic
977785097 4:101023696-101023718 GTCTGGCAAAGACTATCCCAAGG - Exonic
977877245 4:102164294-102164316 ACCTGGCAAGGGTCGTACCATGG - Intergenic
978180138 4:105784297-105784319 ATCTGGTGAGGGTCATCCCATGG + Intronic
978235957 4:106460753-106460775 ATCTGGTGAGGGTCATCCCATGG + Intergenic
979456239 4:120928611-120928633 ATCTGGTGAGGGTCCTCCCATGG - Intergenic
979778868 4:124624366-124624388 ATCTGACAAGGACCATCACATGG + Intergenic
981490347 4:145332718-145332740 ATCTGATGAGGGTCATCCCATGG - Intergenic
981592685 4:146381766-146381788 TTCTGGAAAGGGCCTTCCAAGGG - Intronic
981921069 4:150085372-150085394 ATCTGTTGAGGGTCATCCCATGG + Intronic
984260333 4:177436937-177436959 ATCTGGCAAGGGCCATCCCAAGG - Intronic
984537099 4:180989895-180989917 ATCTCCAAAGGGCCATCCGAGGG + Intergenic
987004686 5:13698140-13698162 ATCTGGTGAGGGTCATTCCATGG - Intronic
987398168 5:17445459-17445481 AACTGGCCAGGGCCAAACCAAGG - Intergenic
989766486 5:45090857-45090879 AACTGCCAGGGGCCAACCCAGGG + Intergenic
990391978 5:55332596-55332618 CTCTGGCGAGAGTCATCCCATGG + Intronic
993453329 5:88098872-88098894 ATCTGGCAAGAGTCACTCCATGG - Intergenic
993597307 5:89874413-89874435 ATGTGGCAAGGGTAGTCCCATGG + Intergenic
994592517 5:101790593-101790615 ATATGGTGAGGGTCATCCCATGG + Intergenic
994592793 5:101792834-101792856 AGCTGGCAAGGGTAATCCCATGG + Intergenic
996926220 5:128829587-128829609 ATATAGCAAGGGCCTTCACAGGG + Intronic
999374467 5:151077115-151077137 ATCTGACAAGGGTCATGCCAAGG + Intronic
999845060 5:155470212-155470234 ATCTGGGAGTGGCCAACCCAGGG - Intergenic
1001288548 5:170440502-170440524 GTCAGGCAAGGGCCCTCCCCTGG - Intronic
1001474256 5:172038771-172038793 GTCTGGCAAGGGTAATCCCATGG + Intergenic
1002174569 5:177394225-177394247 ATCTGGAAAGGCCCATCCTGTGG - Intronic
1002946443 6:1765878-1765900 GTCTCGCAAGGGCCTTCTCAAGG - Intronic
1003458263 6:6304925-6304947 ATTTTTCACGGGCCATCCCATGG + Intronic
1003810713 6:9776891-9776913 ATATGGCAAGGTCTATCCCCAGG + Intronic
1006727473 6:36210400-36210422 ACCTGGGAGGGGCCATCCTACGG + Exonic
1006834533 6:36989456-36989478 GTCTGGGGAGGGTCATCCCATGG + Intergenic
1007071900 6:39043997-39044019 GTCTGGCAAGGGCCAGCCTGAGG + Intergenic
1008241163 6:49113764-49113786 ACCTGGCAACGGTCATCCCATGG + Intergenic
1008433185 6:51445036-51445058 ATCTGGCAGGTGCCTTCCCAGGG - Intergenic
1010604917 6:77876438-77876460 ATCTGGTGAAGGCCATCCCATGG - Intronic
1010932631 6:81820636-81820658 ATCTGGCAAGGGTTATCCCATGG - Intergenic
1011210601 6:84952223-84952245 ATCTGGTTAGGGTTATCCCATGG + Intergenic
1012061344 6:94486683-94486705 ATCTGCAAAGGGTCATCCCATGG - Intergenic
1012132876 6:95519079-95519101 CTCTGGCTAGGGGAATCCCAAGG + Intergenic
1012861875 6:104570104-104570126 ATCCGGCAAGGGTCATCCTATGG + Intergenic
1012956112 6:105571990-105572012 ATCTGGTGAGGGTCATCCTATGG + Intergenic
1013071763 6:106735962-106735984 ATCTGTCAAGGCTCATTCCATGG - Intergenic
1014346273 6:120273213-120273235 ATCTAGCAAGGGTCGTCTCATGG + Intergenic
1015518959 6:134112780-134112802 ATTTGGCAAGGGTCACCCCATGG - Intergenic
1015985475 6:138880276-138880298 ATCTGTCAAGGGCCTTCTCTTGG + Intronic
1017178762 6:151529885-151529907 GTCTGGTGAGGGTCATCCCACGG + Intronic
1017840537 6:158218647-158218669 ATCTGGTGAGGCTCATCCCATGG - Intergenic
1018805274 6:167254484-167254506 CTCTGGGAAGCTCCATCCCATGG + Intergenic
1020989424 7:15178873-15178895 ATCTGGCAAAGGTCATCATACGG + Intergenic
1021862731 7:24923151-24923173 ATCTAGAAAGGGCCATCACTAGG + Intronic
1022904566 7:34843282-34843304 AACTGGCAAAGGTCATCCCATGG + Intronic
1023557050 7:41434826-41434848 ATCTGGCAAGGGTCTTCCCATGG + Intergenic
1023599061 7:41863860-41863882 AACTGGCAAGGGTCATACCATGG + Intergenic
1025002868 7:55331896-55331918 ATCTGGCAAGAGTCATGCCATGG - Intergenic
1027682622 7:81239424-81239446 ATCTAGCAAGGGCTATCCCATGG - Intergenic
1029234012 7:99097569-99097591 ATCTGGCAAGGGCCTTCTTGTGG - Intronic
1030198067 7:106872557-106872579 ATCTGGCAAGGGCGCTATCATGG - Exonic
1031332251 7:120480687-120480709 ATCTGGCAAGAGTCATCCCATGG - Intronic
1031332465 7:120482680-120482702 ATCTGTCAAGGGTCATCCTGTGG - Intronic
1031369261 7:120945070-120945092 ATCTGGTAAGTGCCATGCCAAGG - Intergenic
1033198910 7:139351614-139351636 GTCTGGCAAGGGCCAGGCCCTGG - Intronic
1038746002 8:30255550-30255572 ATCTGGTGAGGGCCATCCCATGG - Intergenic
1039029518 8:33294446-33294468 CTCTGGCTAGCCCCATCCCATGG + Intergenic
1039211360 8:35218649-35218671 ATCTGGCAAGTGTCATCCCAAGG - Intergenic
1040286227 8:46101819-46101841 ATCTTGCCTGGGCCATCCCTGGG + Intergenic
1041718620 8:60955559-60955581 ATTTGGCAAGGGTCATCCCATGG - Intergenic
1042481387 8:69307555-69307577 ATCTGGTGAGGGTCATCCCATGG - Intergenic
1043360833 8:79470078-79470100 ATCTGGCAAGGACCTTCATAAGG - Intergenic
1044002061 8:86894932-86894954 ATCTGGCAAGGGTGATCTAATGG + Intronic
1046179742 8:110629225-110629247 AGCAGGCAAGGCCCATGCCAAGG + Intergenic
1046710218 8:117502968-117502990 ATCTGCCCAGAGCCATGCCAGGG - Intergenic
1047296602 8:123576019-123576041 ATCAGGCAAGGGTCATGCTACGG - Intergenic
1049314155 8:141950949-141950971 ATCTGGCAAGTGCAATCAAATGG - Intergenic
1051668063 9:19483943-19483965 ATGTGGCAGAGGCCATCACATGG - Intergenic
1052447563 9:28584018-28584040 ATCTGGCAAGGAGCATCCCCTGG - Intronic
1054793165 9:69274773-69274795 TTCATGCAAGGGTCATCCCATGG + Intergenic
1055126484 9:72724269-72724291 ACCTGGCAAGGGTCATCCAATGG + Intronic
1056174478 9:84020653-84020675 ATCTGGTGAGGGCCATCCCAGGG + Intergenic
1057425539 9:94946545-94946567 ATCTGAGAAGGGCCATTCTAAGG - Intronic
1062462996 9:136669636-136669658 GCCTGGCAGGGGCCAGCCCAGGG - Exonic
1203660418 Un_KI270753v1:36338-36360 ATCTGACAAGCCCCTTCCCAGGG + Intergenic
1187334590 X:18371126-18371148 ATCTGGCCAGGGTCATCCCATGG - Intergenic
1188430455 X:30101046-30101068 ATCTGGTGAGGGTCATCCTATGG - Intergenic
1189244613 X:39553886-39553908 ATCTGGCAAGGGTCATCCCATGG - Intergenic
1190759728 X:53429448-53429470 ATCTGGCAAGAGCAATGGCAGGG - Intronic
1191841205 X:65514665-65514687 AGCTGGCAAGGGCCCAGCCAGGG + Intronic
1192217776 X:69175890-69175912 ATCTGGTGAGGGTAATCCCATGG - Intergenic
1193662292 X:84271956-84271978 ATCTGACAAGGATTATCCCATGG - Intergenic
1194820173 X:98496157-98496179 ATCTGGTGAAGGCCATCCCATGG - Intergenic
1195913069 X:109908484-109908506 ATTTGGCAAGGGTTATCCCATGG - Intergenic
1196412872 X:115438547-115438569 ATCTGATGAGGGTCATCCCATGG - Intergenic
1197673119 X:129300296-129300318 ATCTGGTGAGGGTCATCTCATGG - Intergenic
1198009278 X:132534222-132534244 ATCTGGCAAGGGTCACCCCATGG + Intergenic
1198087011 X:133291466-133291488 ATCTAGCAAAGGCCATCCCATGG + Intergenic
1200243447 X:154509654-154509676 ATCTGGTGAGGGTCATCCCGTGG + Intronic