ID: 984260333

View in Genome Browser
Species Human (GRCh38)
Location 4:177436937-177436959
Sequence ATCTGGCAAGGGCCATCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 300
Summary {0: 2, 1: 7, 2: 32, 3: 61, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984260333_984260338 6 Left 984260333 4:177436937-177436959 CCTTGGGATGGCCCTTGCCAGAT 0: 2
1: 7
2: 32
3: 61
4: 198
Right 984260338 4:177436966-177436988 GCCCTGTTCTTGAACTTCTCAGG 0: 1
1: 0
2: 2
3: 41
4: 266
984260333_984260341 22 Left 984260333 4:177436937-177436959 CCTTGGGATGGCCCTTGCCAGAT 0: 2
1: 7
2: 32
3: 61
4: 198
Right 984260341 4:177436982-177437004 TCTCAGGCTCCAGAACTGTGAGG 0: 2
1: 20
2: 116
3: 380
4: 940

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984260333 Original CRISPR ATCTGGCAAGGGCCATCCCA AGG (reversed) Intronic