ID: 984260700

View in Genome Browser
Species Human (GRCh38)
Location 4:177441402-177441424
Sequence GGGTCTGAAAATGACTCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 167}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984260699_984260700 -5 Left 984260699 4:177441384-177441406 CCTCAGATGGAGGAGGAGGGGTC 0: 1
1: 0
2: 1
3: 46
4: 347
Right 984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 167
984260691_984260700 20 Left 984260691 4:177441359-177441381 CCCTAGAAAGTTAATACGTTAGC 0: 1
1: 0
2: 0
3: 3
4: 98
Right 984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 167
984260690_984260700 29 Left 984260690 4:177441350-177441372 CCAATTCTGCCCTAGAAAGTTAA 0: 1
1: 0
2: 0
3: 12
4: 143
Right 984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 167
984260692_984260700 19 Left 984260692 4:177441360-177441382 CCTAGAAAGTTAATACGTTAGCA 0: 1
1: 0
2: 1
3: 5
4: 104
Right 984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG 0: 1
1: 0
2: 0
3: 11
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984260700 Original CRISPR GGGTCTGAAAATGACTCTTC TGG Intronic
901447587 1:9317781-9317803 GGCTCTGAAACTGTCTTTTCTGG - Intronic
902490356 1:16776614-16776636 GATCCTGAACATGACTCTTCTGG + Intronic
903305872 1:22412766-22412788 AGGCCTGGAAATGACTCGTCTGG - Intergenic
903984511 1:27216235-27216257 GCGTCTGAAAATGCCTGATCGGG - Intergenic
908481938 1:64549336-64549358 TTTTCTGAAAATGACTCTGCTGG - Intronic
914513228 1:148352685-148352707 GAATGTGAACATGACTCTTCTGG + Intergenic
916638506 1:166700332-166700354 GGGTCTGTAATTGACTCACCTGG + Intergenic
917064578 1:171077622-171077644 GGAACTAAAAATGATTCTTCTGG - Intergenic
917741493 1:177965799-177965821 GGGTCTGAACATGGCTCCTTTGG + Intronic
918035087 1:180862282-180862304 GAGGCTGAAAAAGACTCATCTGG - Intronic
919740389 1:200977644-200977666 GGGTGTGAACATGGATCTTCCGG + Intronic
920095821 1:203486024-203486046 GGATGTGAAAATTACTCTGCAGG - Intronic
920178278 1:204116876-204116898 GGGTATGAAAGGGACTCTGCAGG + Intronic
922184582 1:223262917-223262939 TGGGTTGAAAATGAGTCTTCTGG - Intronic
923530084 1:234805916-234805938 GATCCTGAACATGACTCTTCTGG - Intergenic
1065165872 10:22976401-22976423 AGGACTGAAAATGCCTCTGCAGG - Intronic
1065641696 10:27788815-27788837 GGGTATGCAAATGAATCTTCTGG - Intergenic
1066981240 10:42418462-42418484 TGGCCTGAAACTCACTCTTCAGG + Intergenic
1069100522 10:64314783-64314805 GGGACTGAAAATGACTTTAGAGG + Intergenic
1070890222 10:79937551-79937573 GGGCCTGAAAAGGAGTCTTTGGG + Intergenic
1072836031 10:98713318-98713340 AGGTTTGTAAATGATTCTTCTGG + Intronic
1074195698 10:111182873-111182895 GGGTGGGAACATGACTCTTACGG + Intergenic
1076727832 10:132421636-132421658 GGGGCTAAAAATAACTCTGCTGG - Intergenic
1077052480 11:573605-573627 GGTTCTGAAAATGCCCCTGCAGG - Intergenic
1079095325 11:17506227-17506249 GGGTCTGAAAGTGTGTCTCCTGG - Intronic
1080352528 11:31401708-31401730 TGGTATTAAAATGGCTCTTCTGG + Intronic
1082177883 11:49082707-49082729 GGCTCTTAAAATGATCCTTCTGG - Intergenic
1082266204 11:50121276-50121298 GGCTCTGAAAATGAGATTTCTGG + Intergenic
1082289885 11:50357296-50357318 GGCTCTGAAAATGAGATTTCTGG - Intergenic
1083702552 11:64489372-64489394 GGGGTGGAAAATGACCCTTCTGG + Intergenic
1085234291 11:75000925-75000947 GGGTGTGAAAATATCTCTTTGGG + Intronic
1086687835 11:89753153-89753175 GGCTCTTAAAATGATCCTTCTGG + Intergenic
1086718016 11:90086741-90086763 GGCTCTTAAAATGATCCTTCTGG - Intergenic
1087144953 11:94801773-94801795 GGGTCTGAAGATCACACTTTGGG + Intronic
1088925947 11:114302934-114302956 GGGTCTGATGAGGACTCTTCTGG - Intronic
1091018811 11:132080140-132080162 GAGTTTCATAATGACTCTTCAGG - Intronic
1093098796 12:15002433-15002455 GAGTCTGACAATGGCTCTGCCGG + Intergenic
1093659589 12:21738587-21738609 GGGTGTGCAAATATCTCTTCAGG + Intronic
1096596039 12:52696193-52696215 GACACTGATAATGACTCTTCAGG - Intronic
1097583915 12:61492463-61492485 ATGTTTGATAATGACTCTTCTGG - Intergenic
1097999424 12:65924048-65924070 GGGTCAGAGAATGACTTTCCTGG - Intronic
1102730535 12:115105042-115105064 CTGTCTGAAAGTGATTCTTCTGG + Intergenic
1106343255 13:28851749-28851771 GGGGCGGAAACTGACACTTCGGG - Intronic
1108340384 13:49493777-49493799 GAGTCTGAAAATCTGTCTTCTGG + Exonic
1109477894 13:62908428-62908450 GGTTCTCGAAAAGACTCTTCAGG + Intergenic
1114618110 14:24079149-24079171 GGGTCTCAAAATGATACTCCTGG - Intergenic
1114852362 14:26396567-26396589 GGGGCTGAATATGACTTTTTGGG - Intergenic
1115075951 14:29390589-29390611 GGCTCTGAAAGGGGCTCTTCTGG + Intergenic
1115306804 14:31942164-31942186 GGGTCTTAAAAAGACTATTTTGG - Intergenic
1116583300 14:46670265-46670287 GGGTCAGGAAAGGACTCTGCAGG + Intergenic
1120229996 14:81831564-81831586 AGGGCTGCAGATGACTCTTCAGG - Intergenic
1120745502 14:88147488-88147510 GGGTCTCATAATACCTCTTCTGG + Intergenic
1121046269 14:90790631-90790653 GCATCTGAAAATGGCTCCTCTGG + Intronic
1125059317 15:35400060-35400082 GGCTCTGGAAAAGATTCTTCAGG + Intronic
1125403430 15:39328516-39328538 ATGACTGAAAAGGACTCTTCTGG - Intergenic
1125499163 15:40227630-40227652 TGGTCTGAAAAGGTCTCTCCTGG - Intergenic
1127503811 15:59579121-59579143 GGGTCTGTGAATGAGTCCTCTGG + Intergenic
1129140115 15:73590198-73590220 GGTTCTGAAATCGCCTCTTCAGG + Intronic
1130770508 15:86918915-86918937 GGTTCAGGAAATGATTCTTCTGG + Intronic
1130964814 15:88689344-88689366 GGGTCAGGAAATGAAGCTTCAGG - Intergenic
1135480906 16:22819398-22819420 GGATGTGAAATAGACTCTTCAGG + Intronic
1136629703 16:31482799-31482821 GGATTTGAAAATGATTCCTCTGG + Intergenic
1137375771 16:47950506-47950528 GGGTCGAAAAACGACTTTTCAGG - Intergenic
1137465061 16:48700277-48700299 GGGTCTGAAAGTGCATCTTGAGG + Intergenic
1138084467 16:54121167-54121189 GGGTCAGACAATGACTATTTGGG - Exonic
1140184618 16:72756570-72756592 GGGTGTACAAATGTCTCTTCAGG + Intergenic
1141341671 16:83209479-83209501 AGGTCTGAAAATGTGTCTCCAGG + Intronic
1146987525 17:37234765-37234787 TAGTGAGAAAATGACTCTTCTGG - Intronic
1148771831 17:50071870-50071892 GGCTCTGCAAATGGCTCTTCCGG - Intronic
1156821994 18:41384096-41384118 GCTTCTGAACTTGACTCTTCTGG + Intergenic
1165582886 19:36884439-36884461 GGGTCCAAAGATGAGTCTTCTGG + Intronic
1168491261 19:56812027-56812049 GTGTCTGAATCTTACTCTTCTGG - Exonic
925251526 2:2442906-2442928 AGGAGTGAAAATGACTCTGCAGG - Intergenic
926643235 2:15260275-15260297 TGGTCTGAAAATCACACTTTAGG - Intronic
927454261 2:23235927-23235949 GGGACTCAGAATGACTTTTCTGG + Intergenic
928800284 2:35081378-35081400 TGATGTGAAAATGACTCTCCTGG - Intergenic
930848642 2:55934003-55934025 GGGTCTGAAAAATGATCTTCAGG - Intergenic
933384754 2:81596266-81596288 GGAGCTGAAAATGGCTGTTCGGG - Intergenic
933810664 2:86031062-86031084 GGGTTTGAAAATGACACGTGTGG + Intronic
933990871 2:87633081-87633103 GGGTCAGGAAACGACTCTCCTGG + Intergenic
936302971 2:111317742-111317764 GGGTCAGGAAACGACTCTCCTGG - Intergenic
937299072 2:120827565-120827587 GGGTGTGCAAATATCTCTTCAGG - Intronic
938644486 2:133317079-133317101 AGGTCTGAGAAGGTCTCTTCAGG - Intronic
938852625 2:135276845-135276867 GGTTCAGAAAATGACACCTCTGG + Intronic
939138524 2:138324932-138324954 TGGTCTGTAAACGACTCTTAAGG - Intergenic
939326602 2:140698237-140698259 AAGACTGAAAATTACTCTTCTGG - Intronic
942112246 2:172693906-172693928 AGGTCTGAAAATGGATCTTGAGG - Intergenic
942599825 2:177629348-177629370 TGGACTGAAAATGGCCCTTCAGG + Exonic
944231201 2:197394603-197394625 GGGTATGAAAATGAGTTTCCAGG + Intronic
944857503 2:203782370-203782392 GGGGGTGAAAATGACTCATGGGG + Intergenic
946461208 2:219870392-219870414 GGGGCTGGGAATGACTCTTGGGG + Intergenic
946704313 2:222443342-222443364 GGGTTGAAAAATGACTCATCAGG - Intronic
947061979 2:226177270-226177292 GGGTATGCAAATATCTCTTCAGG - Intergenic
1168969287 20:1919714-1919736 GCTTCTGTAAATGGCTCTTCTGG + Intronic
1169018475 20:2310787-2310809 GGGTCTGAAAATGAGACCCCAGG - Intronic
1172208672 20:33182249-33182271 GGGTGTGATAATGGCTCTCCTGG - Intergenic
1175489309 20:59368579-59368601 AGGTCTGAAAAAGAGGCTTCTGG - Intergenic
1176341611 21:5703171-5703193 GGGTGTGCAAATATCTCTTCCGG - Intergenic
1176473865 21:7135323-7135345 GGGTGTGCAAATATCTCTTCCGG - Intergenic
1176503216 21:7621285-7621307 GGGTGTGCAAATATCTCTTCCGG + Intergenic
1176535932 21:8101240-8101262 GGGTGTGCAAATATCTCTTCCGG - Intergenic
1178413664 21:32386612-32386634 GAGTCTGGCAATGACTCGTCTGG + Intronic
1179074175 21:38103018-38103040 GAGTCTGAAACTGATTCTGCTGG - Intronic
1179239943 21:39581153-39581175 GGTTCTGGAACTGACTCTTGGGG + Intronic
1179429965 21:41314964-41314986 GGGTGTGCAAATATCTCTTCTGG - Intronic
1181453394 22:23038650-23038672 GGGTCAGAAAAGGAGTGTTCAGG + Intergenic
1182504553 22:30772532-30772554 GGCTCTGAAGGTGACACTTCTGG - Intronic
1185057599 22:48589067-48589089 GGGTCTGAAGATGGATTTTCTGG - Intronic
1203240879 22_KI270733v1_random:17635-17657 GGGTGTGCAAATATCTCTTCCGG - Intergenic
952176337 3:30867265-30867287 GGGTATGGAAATGGCTATTCTGG + Intronic
954466439 3:50657913-50657935 GGGTCTGAAAAACCCTCTTCAGG - Intergenic
954520045 3:51216826-51216848 GGGTTTGAAAAAGACTCCTAAGG - Intronic
956084319 3:65593958-65593980 GGGCTTGAAAGTGACTCATCAGG - Intronic
956243367 3:67154370-67154392 GGGTATGAAAAAAACTCTTGTGG - Intergenic
956456884 3:69430305-69430327 GGGTCTGAAAGGGCCTCTTGTGG - Intronic
956535636 3:70272932-70272954 AGGGCTGTAAATGACTCCTCAGG - Intergenic
956908216 3:73789132-73789154 GGCTCTGAAAATGAGATTTCTGG + Intergenic
960064590 3:113357119-113357141 GGGACTGAAAATCACTCATCAGG + Intronic
961267599 3:125657382-125657404 GGGTATAAAAATGTCCCTTCAGG + Intergenic
963327035 3:143874644-143874666 CTGACTGAAAATGATTCTTCTGG + Intergenic
967698800 3:192567544-192567566 GGGGCTTAAAACAACTCTTCTGG + Intronic
967780932 3:193438563-193438585 GGCTCTGAAAATGGCTCATGTGG - Exonic
968192656 3:196681563-196681585 ATGTCTGAGACTGACTCTTCAGG + Intronic
973691739 4:53441410-53441432 GTGTCTGAAAAAGACTCATCAGG + Intronic
975618521 4:76271986-76272008 ATCTCTGAAAATGACTATTCAGG - Intronic
976653717 4:87464475-87464497 GGGTTTGAAAAAGACTATTTTGG + Intergenic
978116196 4:105022775-105022797 TGGTCTGAAACTCACCCTTCAGG - Intergenic
979647070 4:123082187-123082209 GGGTATGGAAATGACTATTTAGG - Intronic
981286462 4:143024656-143024678 GGGTCTGAAATGGGGTCTTCAGG - Intergenic
984068546 4:175082045-175082067 GGGTCTGAAAAGGAGGCCTCAGG + Intergenic
984260700 4:177441402-177441424 GGGTCTGAAAATGACTCTTCTGG + Intronic
994713752 5:103297314-103297336 TGGACTGAAAATGATCCTTCAGG + Intergenic
998953612 5:147415890-147415912 GTGTCTGAGAGTGACTCATCTGG - Intronic
1000403342 5:160857181-160857203 GGGTCTGGAAATGTCTTTTTTGG + Intergenic
1000765645 5:165286014-165286036 GGGTCAGGAAATGACTGTCCTGG - Intergenic
1003592105 6:7445199-7445221 GGATCTGAAGATGATTCTTCAGG + Intergenic
1005605106 6:27469075-27469097 GATTCTCAAAATGACTCGTCTGG + Intronic
1016921609 6:149300524-149300546 TGGACTGAAAATTACTCTTCTGG + Intronic
1017307123 6:152931497-152931519 GGGAATGCAAATGTCTCTTCTGG - Intergenic
1018164878 6:161083818-161083840 GGGTCTGAAACTGTGCCTTCGGG + Intronic
1018825715 6:167406679-167406701 GGGGCTGAGGCTGACTCTTCAGG - Intergenic
1019024478 6:168947401-168947423 GGGTCTGGAAATGACGCCTCTGG + Intergenic
1019922404 7:4171426-4171448 GAATCTGAAAATGATTCTTCTGG - Intronic
1021787894 7:24170877-24170899 GGATCTGAAAATTTCACTTCTGG - Intergenic
1022798796 7:33755296-33755318 GGGTCTGAAATTGAGCCTTGGGG + Intergenic
1023637141 7:42223635-42223657 ACGTCTGCAAATGTCTCTTCAGG + Intronic
1025060553 7:55802679-55802701 GGGTCTGACAATGATTTTTTTGG + Intronic
1026143173 7:67723512-67723534 AGGTCTGAAAATAACGCTGCCGG - Intergenic
1027799604 7:82734915-82734937 GGGTCTGCAAATAGCTCATCTGG - Intergenic
1030607815 7:111656937-111656959 TGGTCCCAAAGTGACTCTTCTGG + Intergenic
1031947753 7:127858977-127858999 GGATGTGAAAATGACTCTCTGGG + Intronic
1035081920 7:156223329-156223351 GTGTCTGCATATGATTCTTCTGG - Intergenic
1036150052 8:6288661-6288683 GCTATTGAAAATGACTCTTCAGG - Intergenic
1037167938 8:15853715-15853737 GGCTCTGATGATAACTCTTCTGG - Intergenic
1039989956 8:42479039-42479061 GGCTCGGGACATGACTCTTCTGG + Intronic
1040604656 8:48919980-48920002 GGGTCCGAATATGCATCTTCAGG + Exonic
1041598381 8:59684731-59684753 GGGACTGAAAATGATTCATTGGG + Intergenic
1042751744 8:72164805-72164827 GTGTCTGAATATGCCTATTCAGG + Intergenic
1045560161 8:103254214-103254236 GGATCTGATGATGACTCTTGGGG - Intergenic
1046354724 8:113066995-113067017 GGCTCTAAAAATGATTCTTCAGG - Intronic
1046810369 8:118526627-118526649 GGGTATGAACAGCACTCTTCTGG - Intronic
1048592838 8:135837493-135837515 TGGGCTGAAAATGCATCTTCAGG - Intergenic
1050186736 9:2982688-2982710 AGGTCTGATAATGATCCTTCTGG - Intergenic
1050669563 9:7980835-7980857 GGGCTTTAAAATGTCTCTTCAGG + Intergenic
1051095932 9:13465145-13465167 AAGTCTGAAAATGGATCTTCAGG + Intergenic
1051230631 9:14951276-14951298 GAGACTGGAAAAGACTCTTCAGG + Intergenic
1052842668 9:33306410-33306432 GGGTCTGAAACTGAAGATTCAGG + Intronic
1055688922 9:78808966-78808988 GGGTCTTGAAATGTCTTTTCAGG - Intergenic
1057289032 9:93788671-93788693 GGGCCTGAAACTTACCCTTCAGG + Intergenic
1058347677 9:103982965-103982987 GGGTCTGAAACTGACTCAAGTGG + Intergenic
1058399932 9:104603962-104603984 GGGTTTGAAAATCAGTCTACTGG - Intergenic
1203457208 Un_GL000220v1:723-745 GGGTGTGCAAATATCTCTTCCGG - Intergenic
1186551367 X:10509301-10509323 AGGTCTGAAAATGACTTAACAGG - Intronic
1190718963 X:53131043-53131065 GGCTTTGAAGATGGCTCTTCAGG + Intergenic
1195297254 X:103491064-103491086 GGGTTTTGAAAGGACTCTTCAGG - Intergenic
1197362633 X:125525248-125525270 GGGTGTGAAAATATCTCTTTTGG + Intergenic
1200041599 X:153374851-153374873 GGTTCTCAGAATGACTCTCCCGG - Intergenic
1200427242 Y:3034995-3035017 AGGTCTGCAACTTACTCTTCAGG + Intergenic
1201241812 Y:11964536-11964558 GGGTCTGCAAGTTACTATTCTGG - Intergenic