ID: 984262203

View in Genome Browser
Species Human (GRCh38)
Location 4:177455554-177455576
Sequence CAGAGTTTCCACTGTGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984262203_984262207 26 Left 984262203 4:177455554-177455576 CCCGCTTCACAGTGGAAACTCTG No data
Right 984262207 4:177455603-177455625 ATCTAACATGGTGAGTACCCAGG No data
984262203_984262205 0 Left 984262203 4:177455554-177455576 CCCGCTTCACAGTGGAAACTCTG No data
Right 984262205 4:177455577-177455599 TTGCGCTTATTTTAATGTGAAGG No data
984262203_984262206 14 Left 984262203 4:177455554-177455576 CCCGCTTCACAGTGGAAACTCTG No data
Right 984262206 4:177455591-177455613 ATGTGAAGGAAAATCTAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984262203 Original CRISPR CAGAGTTTCCACTGTGAAGC GGG (reversed) Intergenic
No off target data available for this crispr