ID: 984267096

View in Genome Browser
Species Human (GRCh38)
Location 4:177508257-177508279
Sequence GAGGAATGTTAGCATGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984267096_984267104 27 Left 984267096 4:177508257-177508279 CCTTACACATGCTAACATTCCTC No data
Right 984267104 4:177508307-177508329 ACCTCACGTTTTTTATTACCTGG No data
984267096_984267106 28 Left 984267096 4:177508257-177508279 CCTTACACATGCTAACATTCCTC No data
Right 984267106 4:177508308-177508330 CCTCACGTTTTTTATTACCTGGG No data
984267096_984267107 29 Left 984267096 4:177508257-177508279 CCTTACACATGCTAACATTCCTC No data
Right 984267107 4:177508309-177508331 CTCACGTTTTTTATTACCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984267096 Original CRISPR GAGGAATGTTAGCATGTGTA AGG (reversed) Intergenic
No off target data available for this crispr