ID: 984268201

View in Genome Browser
Species Human (GRCh38)
Location 4:177519686-177519708
Sequence AATCATATGAAACTGCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984268201_984268204 17 Left 984268201 4:177519686-177519708 CCAGGCAGCAGTTTCATATGATT No data
Right 984268204 4:177519726-177519748 TGAAATAGCATCATAAGCTAGGG No data
984268201_984268205 18 Left 984268201 4:177519686-177519708 CCAGGCAGCAGTTTCATATGATT No data
Right 984268205 4:177519727-177519749 GAAATAGCATCATAAGCTAGGGG No data
984268201_984268203 16 Left 984268201 4:177519686-177519708 CCAGGCAGCAGTTTCATATGATT No data
Right 984268203 4:177519725-177519747 TTGAAATAGCATCATAAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984268201 Original CRISPR AATCATATGAAACTGCTGCC TGG (reversed) Intergenic
No off target data available for this crispr