ID: 984269573

View in Genome Browser
Species Human (GRCh38)
Location 4:177534937-177534959
Sequence CTGTTTATAAAGATGCAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984269573_984269580 26 Left 984269573 4:177534937-177534959 CCTAGCTGCATCTTTATAAACAG No data
Right 984269580 4:177534986-177535008 GATAGTAAAATTGCAAAACAGGG No data
984269573_984269579 25 Left 984269573 4:177534937-177534959 CCTAGCTGCATCTTTATAAACAG No data
Right 984269579 4:177534985-177535007 AGATAGTAAAATTGCAAAACAGG No data
984269573_984269575 0 Left 984269573 4:177534937-177534959 CCTAGCTGCATCTTTATAAACAG No data
Right 984269575 4:177534960-177534982 TTATTATCTTACCCAGAAGTGGG No data
984269573_984269574 -1 Left 984269573 4:177534937-177534959 CCTAGCTGCATCTTTATAAACAG No data
Right 984269574 4:177534959-177534981 GTTATTATCTTACCCAGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984269573 Original CRISPR CTGTTTATAAAGATGCAGCT AGG (reversed) Intergenic
No off target data available for this crispr