ID: 984273363

View in Genome Browser
Species Human (GRCh38)
Location 4:177575475-177575497
Sequence TCATGAATACTGCAGTCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984273363_984273367 10 Left 984273363 4:177575475-177575497 CCCCTTGACTGCAGTATTCATGA No data
Right 984273367 4:177575508-177575530 ACTGGCACCTTTTAATATAAAGG No data
984273363_984273366 -8 Left 984273363 4:177575475-177575497 CCCCTTGACTGCAGTATTCATGA No data
Right 984273366 4:177575490-177575512 ATTCATGATATATGATATACTGG No data
984273363_984273369 18 Left 984273363 4:177575475-177575497 CCCCTTGACTGCAGTATTCATGA No data
Right 984273369 4:177575516-177575538 CTTTTAATATAAAGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984273363 Original CRISPR TCATGAATACTGCAGTCAAG GGG (reversed) Intergenic
No off target data available for this crispr