ID: 984273369

View in Genome Browser
Species Human (GRCh38)
Location 4:177575516-177575538
Sequence CTTTTAATATAAAGGCCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984273364_984273369 17 Left 984273364 4:177575476-177575498 CCCTTGACTGCAGTATTCATGAT No data
Right 984273369 4:177575516-177575538 CTTTTAATATAAAGGCCATCAGG No data
984273363_984273369 18 Left 984273363 4:177575475-177575497 CCCCTTGACTGCAGTATTCATGA No data
Right 984273369 4:177575516-177575538 CTTTTAATATAAAGGCCATCAGG No data
984273365_984273369 16 Left 984273365 4:177575477-177575499 CCTTGACTGCAGTATTCATGATA No data
Right 984273369 4:177575516-177575538 CTTTTAATATAAAGGCCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984273369 Original CRISPR CTTTTAATATAAAGGCCATC AGG Intergenic
No off target data available for this crispr