ID: 984279942

View in Genome Browser
Species Human (GRCh38)
Location 4:177658292-177658314
Sequence CTTTATTAGCAGCACGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984279936_984279942 7 Left 984279936 4:177658262-177658284 CCTTCATAAATTACCCAGTCTTG 0: 41
1: 1503
2: 2648
3: 4228
4: 3750
Right 984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG No data
984279939_984279942 -6 Left 984279939 4:177658275-177658297 CCCAGTCTTGGGTACGTCTTTAT 0: 40
1: 2287
2: 4325
3: 7993
4: 10093
Right 984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG No data
984279934_984279942 22 Left 984279934 4:177658247-177658269 CCATTAAACCTCTTTCCTTCATA 0: 33
1: 770
2: 1076
3: 1768
4: 2488
Right 984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG No data
984279940_984279942 -7 Left 984279940 4:177658276-177658298 CCAGTCTTGGGTACGTCTTTATT 0: 17
1: 939
2: 3071
3: 5544
4: 8304
Right 984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG No data
984279935_984279942 14 Left 984279935 4:177658255-177658277 CCTCTTTCCTTCATAAATTACCC 0: 153
1: 4365
2: 8984
3: 8775
4: 7788
Right 984279942 4:177658292-177658314 CTTTATTAGCAGCACGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984279942 Original CRISPR CTTTATTAGCAGCACGAGGA TGG Intergenic
No off target data available for this crispr