ID: 984285503 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:177723444-177723466 |
| Sequence | CCGTAGCCATAGAGTGAGGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 984285503_984285507 | 22 | Left | 984285503 | 4:177723444-177723466 | CCATCCTCACTCTATGGCTACGG | No data | ||
| Right | 984285507 | 4:177723489-177723511 | TTGGCTGTCTAAGCCTTAGCAGG | No data | ||||
| 984285503_984285506 | 3 | Left | 984285503 | 4:177723444-177723466 | CCATCCTCACTCTATGGCTACGG | No data | ||
| Right | 984285506 | 4:177723470-177723492 | TCTTAACTGAAACTAACTTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 984285503 | Original CRISPR | CCGTAGCCATAGAGTGAGGA TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||