ID: 984285503

View in Genome Browser
Species Human (GRCh38)
Location 4:177723444-177723466
Sequence CCGTAGCCATAGAGTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984285503_984285507 22 Left 984285503 4:177723444-177723466 CCATCCTCACTCTATGGCTACGG No data
Right 984285507 4:177723489-177723511 TTGGCTGTCTAAGCCTTAGCAGG No data
984285503_984285506 3 Left 984285503 4:177723444-177723466 CCATCCTCACTCTATGGCTACGG No data
Right 984285506 4:177723470-177723492 TCTTAACTGAAACTAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984285503 Original CRISPR CCGTAGCCATAGAGTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr