ID: 984286147

View in Genome Browser
Species Human (GRCh38)
Location 4:177731046-177731068
Sequence GTGGTAGCCCTGGACATGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 176}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984286147 Original CRISPR GTGGTAGCCCTGGACATGGG TGG (reversed) Intronic
900519881 1:3100412-3100434 GTGGTGGCCTGGGACATGGATGG + Intronic
900773021 1:4560959-4560981 GTTATGGCCCTGGAGATGGGTGG + Intergenic
901410356 1:9078750-9078772 ATAGCTGCCCTGGACATGGGTGG + Intronic
902332980 1:15739566-15739588 GTGGATGCTCTGGACCTGGGTGG - Exonic
904321220 1:29698835-29698857 CTGGTTGCCATGGAAATGGGTGG - Intergenic
904623408 1:31789004-31789026 GAGGAAGCCCTGGACCTGGAGGG + Intergenic
906217973 1:44055247-44055269 TTGGTAACCCTGGACACGGCAGG + Intergenic
907540664 1:55214073-55214095 GTGGGAGGCCTGGGCAGGGGTGG - Intronic
911924970 1:103817821-103817843 GTGATAGCCCTGGCCCAGGGAGG - Intergenic
913344266 1:117792597-117792619 CTGGGAGCCCTGGAGATGGGAGG + Intergenic
915322263 1:155062373-155062395 GGAGGAGCCCTGGGCATGGGTGG + Intronic
917854773 1:179091381-179091403 GTGGTGGTCCTGAAGATGGGAGG + Intronic
917869166 1:179227026-179227048 GTGGTGGCAGTGGAAATGGGAGG - Intronic
919974596 1:202602493-202602515 CTGCCTGCCCTGGACATGGGAGG - Exonic
923956306 1:239025565-239025587 GTGGTAGGCCTGGTGATGGATGG - Intergenic
1063925797 10:10976014-10976036 GTTGTTGCCCTGGAAAGGGGTGG + Intergenic
1068229141 10:54148567-54148589 GTGGAAGCCGTGGATATGGAGGG + Intronic
1068886447 10:62102810-62102832 GTGGAAGCTCAGGACAGGGGAGG + Intergenic
1072396699 10:95050308-95050330 GTGGTACCTCTGGACATGCCTGG + Intronic
1073847442 10:107573888-107573910 GTGGTTGCCATGGACATGGATGG + Intergenic
1076785080 10:132745655-132745677 GTGGTGGCCCTGGGCATGGTGGG + Intronic
1076785131 10:132745809-132745831 GTGGTGGCCCTGGGTATGGTGGG + Intronic
1078513913 11:12007478-12007500 CAGGTAGCCCTGGGCATGCGTGG + Intronic
1079010445 11:16823674-16823696 GTTGGAGTTCTGGACATGGGTGG - Intronic
1081794337 11:45809278-45809300 GTGGGAGCTCTGGGCAAGGGAGG + Intronic
1082163207 11:48907211-48907233 GTGGGAGCACTGGCTATGGGTGG - Intergenic
1083231771 11:61326079-61326101 GTGGTAGCCCTGATAATGGGGGG - Intronic
1090848166 11:130547330-130547352 CAGGTAGCCCAGGACATGGAGGG - Intergenic
1091209544 11:133844524-133844546 GTGGATGTCCTGGCCATGGGTGG + Exonic
1091613724 12:2033305-2033327 GTGGTGGCCGAGCACATGGGCGG - Intronic
1091717463 12:2789370-2789392 CTGGAAGCCCTGGCCAGGGGTGG - Intergenic
1093542706 12:20305863-20305885 GTGGTGGCCCTGGCTCTGGGTGG - Intergenic
1096035731 12:48468381-48468403 GGGGTAGGCCTGGACATGGAAGG + Intergenic
1096532213 12:52249226-52249248 CTGGCAGCTCTGGGCATGGGGGG - Intronic
1098376409 12:69820353-69820375 GTGGTAGCAGTGGACATGGAGGG - Exonic
1098539469 12:71637934-71637956 GTGGGAGGACTGGAGATGGGGGG + Intronic
1101998269 12:109540513-109540535 CTGGTAACCCTGCACATAGGGGG - Intergenic
1102907343 12:116687173-116687195 GTGGAAACCCTTGAAATGGGAGG + Intergenic
1104921479 12:132292878-132292900 GTGAAAGCCCTGCACATGCGAGG - Intronic
1105072422 12:133242820-133242842 GGGGCTGCCCTGCACATGGGAGG + Intergenic
1105986642 13:25573691-25573713 GTGGCAGCCCTGGTGCTGGGTGG + Intronic
1108255323 13:48604086-48604108 GTGGTTGCCTAGGACAAGGGGGG - Intergenic
1108444954 13:50498913-50498935 GTGGAACCCATGGACATGGAGGG - Intronic
1117827509 14:59718946-59718968 GTGGTAGCATTGGAGATGAGAGG - Intronic
1118261901 14:64255565-64255587 GTGGTGGAGCTGGACTTGGGGGG - Intronic
1119378677 14:74214917-74214939 GTGGCAACAGTGGACATGGGTGG + Intergenic
1120623067 14:86790242-86790264 GTGGTAGCCCGGGGCTTGTGGGG - Intergenic
1122298033 14:100716502-100716524 GGGGTAGCCCTGGACCAGGTGGG - Intergenic
1122387956 14:101361828-101361850 GTGGAAGCGCTGGAAATGTGTGG - Intergenic
1122972884 14:105159454-105159476 CAGGGAGCCCTGGAGATGGGCGG - Intronic
1123467973 15:20530150-20530172 GCTGTAGCCGTGGAGATGGGAGG + Intergenic
1123650140 15:22470892-22470914 GCTGTAGCCGTGGAGATGGGAGG - Intergenic
1123728286 15:23125359-23125381 GCTGTAGCCGTGGAGATGGGAGG + Intergenic
1123740546 15:23279734-23279756 GCTGTAGCCGTGGAGATGGGAGG - Intergenic
1123746452 15:23322824-23322846 GCTGTAGCCGTGGAGATGGGAGG + Intergenic
1124278719 15:28346141-28346163 GCTGTAGCCGTGGAGATGGGAGG + Intergenic
1124303980 15:28565467-28565489 GCTGTAGCCGTGGAGATGGGAGG - Intergenic
1124532861 15:30521942-30521964 GCTGTAGCCGTGGAGATGGGAGG - Intergenic
1124765795 15:32485702-32485724 GCTGTAGCCGTGGAGATGGGAGG + Intergenic
1125143721 15:36440812-36440834 GTGGCAGTCCTGGACCTGGGAGG + Intergenic
1126302453 15:47213373-47213395 GTGGTAGCGCTGGTCATCTGTGG - Intronic
1127715386 15:61644558-61644580 GGGCTAGCCCTGGAGATGGCAGG - Intergenic
1128238431 15:66083004-66083026 CTGGTAGCCCAGGACATAGGGGG - Intronic
1130966319 15:88700319-88700341 CTGGTAGCCATGGGCAGGGGAGG - Intergenic
1132810491 16:1794529-1794551 GGGGTGGCCTTGGACATGGCTGG - Intronic
1133117794 16:3588003-3588025 GTGGCATCCCTGCACCTGGGAGG + Intronic
1135589027 16:23692063-23692085 GTGGTTGCCCGGGACCTGGTTGG - Exonic
1135871699 16:26157090-26157112 GTGGTAGACTTGGAGAGGGGTGG + Intergenic
1136555568 16:31005892-31005914 GTGGAAGACCTGGACTTAGGGGG - Intronic
1136577090 16:31131354-31131376 CTGGTGGCCCTGGACTTTGGAGG + Exonic
1138008663 16:53358854-53358876 GCTGTAGCCATGGAGATGGGAGG + Intergenic
1139432964 16:66920931-66920953 GAGGGAGCCATGGGCATGGGTGG + Intergenic
1139908624 16:70382910-70382932 GTTGTAGATCTGGACCTGGGAGG + Exonic
1141426396 16:83947203-83947225 TGGGTGGCCGTGGACATGGGCGG + Intronic
1142288861 16:89183554-89183576 GCGTTTGCCCTGGACCTGGGAGG + Exonic
1145265326 17:21377125-21377147 GTGGTAGCCGGAGACATGGCAGG - Intronic
1146178324 17:30680730-30680752 GTGGTGGCCTTGGAGGTGGGAGG + Intergenic
1147272948 17:39289561-39289583 GTGGGAGCCCAGGAGATGGAGGG + Intronic
1148961377 17:51396147-51396169 GTGGTACTCCTGCCCATGGGGGG - Intergenic
1151458870 17:74242941-74242963 GTGGTAGCCCCAGCCATGTGTGG + Intronic
1152858091 17:82677650-82677672 GTGCTGGCCCTGGAGACGGGTGG - Intronic
1153250849 18:3119934-3119956 GTGGCAGCCATGAACATGGCTGG - Exonic
1155903911 18:31426263-31426285 ATGGAAGACCTGGACATGTGAGG + Intergenic
1156069554 18:33189889-33189911 GTGGTAGCCCTAATCTTGGGTGG + Intronic
1157074329 18:44448603-44448625 TTGGAAGCCCTGGAAATGGATGG - Intergenic
1157938014 18:51894387-51894409 TGGATATCCCTGGACATGGGTGG + Intergenic
1158514501 18:58119836-58119858 CTGGCAGGCCTGGACATTGGCGG + Intronic
1160364418 18:78312331-78312353 GTGTTTGCCGTGGAAATGGGGGG + Intergenic
1161590427 19:5126926-5126948 GTGGTGTCCTTGGAAATGGGTGG + Intronic
1162980276 19:14234723-14234745 GTGGTGGCCTTGGAGGTGGGAGG - Intergenic
1163267434 19:16229375-16229397 GAGCTGGCCCAGGACATGGGCGG - Intronic
1164922568 19:32100152-32100174 GTTGCAGCCATGGAGATGGGAGG - Intergenic
1165102017 19:33444612-33444634 CTGGTAGGCTTGGCCATGGGAGG - Intronic
1165227706 19:34366061-34366083 GTGGAAGCCCTGGGAAGGGGTGG + Intronic
1165834503 19:38745876-38745898 TTGGTAGCCGTGTACGTGGGTGG - Intronic
1167825646 19:51970542-51970564 GTGGAAGCCATGGATATGGAGGG + Intronic
1168513460 19:56991852-56991874 GTGGTATCACTGGCCAGGGGTGG - Intergenic
926181357 2:10646713-10646735 GTGGTGGCCCTGAGCAAGGGAGG - Intronic
929181519 2:39045189-39045211 GTGGAAGCCATGGATATGGAGGG + Intronic
932191785 2:69747114-69747136 GAGGTAGAGGTGGACATGGGGGG - Intronic
932748717 2:74357031-74357053 TTGGTAGCCCTGGCCAGGCGCGG - Intronic
933542360 2:83663275-83663297 GTGGAACCACTGGATATGGGAGG - Intergenic
933674499 2:85042409-85042431 GTGGTAGCGCTGGAGATGAGGGG - Intronic
936440959 2:112552834-112552856 GTGGTACCACTGGCCAAGGGTGG - Intronic
937090766 2:119204881-119204903 GTGGTGGCCCTGCACAGGGACGG + Intergenic
937271703 2:120656991-120657013 GTGGGTGCCCTGGACATCAGAGG + Intergenic
937347629 2:121136391-121136413 GTGGTTGCCATGGAAAGGGGCGG + Intergenic
939108493 2:137977927-137977949 GCTGGAGCCCTGGAGATGGGGGG - Intronic
939142825 2:138376397-138376419 CTGGCAGCCCCAGACATGGGAGG + Intergenic
942455261 2:176133797-176133819 GTGGGAGCCCTGTGTATGGGTGG + Intergenic
944442288 2:199754431-199754453 CTGGTGGCCCTGCAGATGGGAGG + Intergenic
945232259 2:207604750-207604772 GTGGTTGCCAGGGACAAGGGCGG - Intronic
945878791 2:215305581-215305603 GTGGCAGCAGTGGACATTGGAGG - Intergenic
948082192 2:235215473-235215495 GAGGTAGCCTTGAACCTGGGTGG - Intergenic
1169271050 20:4199677-4199699 GTGGTTGCCATGGAAAGGGGTGG + Intergenic
1170702106 20:18712996-18713018 GTGGAAACCCAGGACAGGGGAGG - Intronic
1170821598 20:19759060-19759082 GTGGGAGCCCAGGCCAAGGGTGG - Intergenic
1170844785 20:19953226-19953248 GAGGCAGCCTTGAACATGGGAGG - Intronic
1171313935 20:24169515-24169537 GTGGTTGCCATGGAAAGGGGTGG - Intergenic
1171331230 20:24340358-24340380 GTGGAAGCCCAGGACTTGGGTGG - Intergenic
1173644348 20:44624257-44624279 GTGGTAGCCATTGACCTGGCTGG - Exonic
1175539447 20:59739135-59739157 GTGGGAGCCCAGGAAATGTGTGG - Intronic
1177452435 21:21288258-21288280 GTGGAATCCATGGATATGGGGGG + Intronic
1181456504 22:23063023-23063045 GTGGTCACAGTGGACATGGGAGG + Intronic
1181572491 22:23775147-23775169 GGGGAAGCCCTGGAGGTGGGAGG + Intronic
1182149414 22:28017829-28017851 GTGTTAGCCCTGGGGATGGGGGG - Intronic
1182396628 22:30040908-30040930 GAAGCAGCCCTGGGCATGGGGGG - Intergenic
1182510806 22:30818818-30818840 GTGGTAACCATAGACATGGGAGG + Intronic
1183224302 22:36538785-36538807 GGGGTAGCCCTGGACTTGCCTGG + Intergenic
1183323491 22:37179023-37179045 GGGGTAGCCTCTGACATGGGAGG + Intergenic
1184306337 22:43605078-43605100 GTGTTGACCCTGGACATGGGAGG - Intronic
952234197 3:31462322-31462344 GTGGTAGCCATGGACAAATGTGG + Intergenic
953374495 3:42417257-42417279 GTGGCAGCCCTGGGCCTTGGAGG + Intergenic
954436554 3:50499309-50499331 GTGGGAGCCCTGGAGACTGGTGG + Intronic
954848139 3:53577702-53577724 GTGGCCGCCCTGGAGATGTGAGG + Intronic
955047536 3:55374187-55374209 TTGGTAACCCCTGACATGGGTGG - Intergenic
955088104 3:55722383-55722405 GTGGAAGCCCTGTGCATGGAGGG - Intronic
963222626 3:142827915-142827937 GTGCAAGCCCGGGACCTGGGAGG + Intronic
967284862 3:187859179-187859201 GTGGAAGCCCTGTGCCTGGGTGG + Intergenic
967840935 3:194003879-194003901 GTGGTGGCCACGGACATGTGTGG + Intergenic
968600134 4:1504788-1504810 GTGGTTGCCATGGAAAGGGGCGG + Intergenic
970230967 4:13910729-13910751 GTGGTTGCCCAGGACATGGTGGG + Intergenic
971478013 4:27090252-27090274 GTGCTCTTCCTGGACATGGGTGG + Intergenic
974388502 4:61233810-61233832 GTAGTAGCCATGGAAATGGTGGG + Intronic
983186417 4:164706083-164706105 GTGGTGGGGCTGGCCATGGGTGG - Intergenic
984286147 4:177731046-177731068 GTGGTAGCCCTGGACATGGGTGG - Intronic
984429264 4:179627163-179627185 GTGAGAGCCCTGGACATGATTGG - Intergenic
985716602 5:1466654-1466676 GTGGGAGCCCAGGACAGGAGTGG - Intronic
986730148 5:10629243-10629265 GTGGTAGCCCAGGTCAGGGATGG + Intronic
987412093 5:17624855-17624877 GTCATAGCCCTGGCCATGGCTGG - Intergenic
987911744 5:24155459-24155481 GTGGTGGCCGTGGCCATGGAGGG + Intronic
988868793 5:35365103-35365125 GTGGTAAACTTGGAGATGGGAGG - Intergenic
990819797 5:59825407-59825429 GTGGTGGCACTGCACATGGGTGG + Intronic
992084459 5:73265506-73265528 ATGGTATCCCTGGGCAAGGGTGG + Intergenic
994018510 5:94996718-94996740 GTTGAATCCATGGACATGGGAGG + Intronic
995783843 5:115807348-115807370 TTGGTAACCCTGAACATGAGTGG - Intronic
998311347 5:141136092-141136114 GTGGTGGTCCCGGACCTGGGCGG - Exonic
998957158 5:147450608-147450630 GTGGTAGGGCTGGAAATGAGGGG - Intronic
1001633924 5:173196450-173196472 GAGGTGGCCCTGGACAGGGGCGG - Intergenic
1007223831 6:40299240-40299262 GTGGGAGCCATGGCCATAGGGGG + Intergenic
1015513753 6:134064674-134064696 GGGGTTACCCTGGACATGGAAGG + Intergenic
1017774714 6:157671939-157671961 GAAGAAGCCCTGGAGATGGGTGG - Intronic
1018385390 6:163298952-163298974 GTGGTAGAGATGGACTTGGGGGG - Intronic
1019068843 6:169325229-169325251 GGGGTGGCCCTGGACATAGATGG + Intergenic
1019170894 6:170132617-170132639 GTGGCTGCCCCAGACATGGGGGG + Intergenic
1019285829 7:222485-222507 GTGCCAGCCCTGGGCCTGGGGGG - Intronic
1022048020 7:26638798-26638820 GTGGTAGCCCTGGGCCTATGAGG - Exonic
1023999674 7:45182251-45182273 GTGCTAGCCCTGCACAGAGGGGG + Intronic
1025272060 7:57531312-57531334 GTGGTTGCCAAGGACATAGGAGG - Intergenic
1035162455 7:156961095-156961117 CTGGGAGCCATGGAAATGGGTGG + Intronic
1036612500 8:10362509-10362531 GTGGTGGAACTGGGCATGGGAGG + Intronic
1037632977 8:20675060-20675082 ATGGTGGCCCTGGAGATGTGAGG - Intergenic
1039381132 8:37086418-37086440 CAGGTAGACCTGTACATGGGAGG - Intergenic
1039382142 8:37095722-37095744 GTGGTTTCTCTGGAAATGGGCGG - Intergenic
1042878219 8:73459620-73459642 GTGGGAGCTCTGCACATGGTAGG - Intronic
1047085090 8:121507114-121507136 GTGGTAGCACTGAAAATTGGTGG + Intergenic
1048442657 8:134471391-134471413 GTGTTAGCCCTGGAGAAGGAAGG - Intergenic
1049253820 8:141603453-141603475 GTGGAGGCCCTGGATCTGGGAGG - Intergenic
1052888902 9:33677223-33677245 GTGGAAGCCGTGGGCTTGGGCGG - Intergenic
1053122597 9:35558032-35558054 GTGGTAGCGCGGGACAGGTGAGG - Intronic
1055357122 9:75449072-75449094 GTGGGAGCCGGGGACAGGGGAGG + Intergenic
1056552063 9:87660182-87660204 GTGGAGGCCCAGGAGATGGGAGG + Intronic
1057477302 9:95413592-95413614 GTGGAACCCTTGGACATGGAGGG + Intergenic
1059168319 9:112099960-112099982 GTTGTGGCCATGGATATGGGTGG - Intronic
1062389824 9:136329535-136329557 GTGGATGCCCTGGAGGTGGGCGG + Intronic
1062405754 9:136395516-136395538 TGGGGAGCCCTGGACCTGGGAGG + Intronic
1062478949 9:136742686-136742708 CTGGTAGCCCTGCTCCTGGGCGG + Intronic
1062624499 9:137436684-137436706 GTGGGTGCCCTGGACATGGGAGG - Exonic
1190628647 X:52363465-52363487 GTGGTTGCCATGGAAAGGGGTGG - Intergenic
1190633480 X:52411681-52411703 GTGGGGGGCCTGGACAGGGGAGG - Intergenic
1193152551 X:78139944-78139966 GTGGTAGCCGTGGAGGTGTGAGG - Intergenic
1195465154 X:105171873-105171895 GTGGTAGAGGTGGACATGGAGGG - Intronic
1197455260 X:126670887-126670909 ATGGGAGCCCTGGACAAGGAAGG + Intergenic
1200114549 X:153764476-153764498 GTGGTAGCCCTGGGGTTAGGAGG + Intronic