ID: 984288701

View in Genome Browser
Species Human (GRCh38)
Location 4:177765774-177765796
Sequence CTTAGTGAGCTATTTGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984288696_984288701 25 Left 984288696 4:177765726-177765748 CCATTCTAGATGCTCATGGACTT 0: 1
1: 0
2: 3
3: 16
4: 115
Right 984288701 4:177765774-177765796 CTTAGTGAGCTATTTGGGATAGG 0: 1
1: 0
2: 1
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984288701 Original CRISPR CTTAGTGAGCTATTTGGGAT AGG Intronic