ID: 984288701

View in Genome Browser
Species Human (GRCh38)
Location 4:177765774-177765796
Sequence CTTAGTGAGCTATTTGGGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984288696_984288701 25 Left 984288696 4:177765726-177765748 CCATTCTAGATGCTCATGGACTT 0: 1
1: 0
2: 3
3: 16
4: 115
Right 984288701 4:177765774-177765796 CTTAGTGAGCTATTTGGGATAGG 0: 1
1: 0
2: 1
3: 6
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984288701 Original CRISPR CTTAGTGAGCTATTTGGGAT AGG Intronic
902173925 1:14635270-14635292 CTAAGTGTCCTATTTGGGGTAGG + Intronic
903440272 1:23382864-23382886 CTTATTGAGCACTTAGGGATGGG - Intronic
903611673 1:24619383-24619405 CTTAGTGGGCTATTTGGAAAAGG - Intergenic
909329644 1:74396137-74396159 CTTTGTGAGATGTTTGAGATGGG - Intronic
910632525 1:89370575-89370597 CTTTGAGAGTTATTTGGGAATGG + Intronic
910897325 1:92082498-92082520 TTGAGTGAGCTCTTAGGGATTGG + Intronic
911455882 1:98123162-98123184 CTTAGTGATTTATTTGGGGCTGG - Intergenic
911868987 1:103067321-103067343 CTTAGAGAGCTTATTGGTATTGG - Intronic
913242550 1:116841813-116841835 CTGAGTTAGCTATATGGGAAAGG - Intergenic
917768591 1:178250500-178250522 CTTGCTGAGCTGTTTGGGAGTGG + Intronic
920363234 1:205433741-205433763 CTTAGTGAGCGCTTTGTGCTAGG + Intronic
920612284 1:207453629-207453651 CTTAGTGAACCATTTAGAATAGG + Intergenic
1064582519 10:16808742-16808764 CATGTTGAGGTATTTGGGATTGG - Intronic
1078039881 11:7850402-7850424 CATAGTGAGTTTTTTGGGAGGGG + Intergenic
1078678846 11:13455429-13455451 TTTATTGAGCTGTTTGTGATGGG - Intronic
1086613999 11:88792691-88792713 CATACTGAGGTATTTGGGAAGGG + Intronic
1086872060 11:92049565-92049587 CTCAGTGAGCCAGTTAGGATAGG - Intergenic
1086873697 11:92070242-92070264 TTTAGTAAACAATTTGGGATAGG + Intergenic
1087828488 11:102793491-102793513 TTTGGTGAGCCATTAGGGATCGG + Intronic
1091008617 11:131977390-131977412 CATACAGAGCTATTTGGCATGGG - Intronic
1092517407 12:9229550-9229572 TCTATTAAGCTATTTGGGATTGG + Intergenic
1095057465 12:37630113-37630135 CTTTGTGAACTATTTTGGAATGG - Intergenic
1096477942 12:51920166-51920188 GTTGATGAGCTTTTTGGGATGGG + Intronic
1099056162 12:77843761-77843783 CTTTGTGAGATGTTTGGCATTGG - Intronic
1099419667 12:82441322-82441344 CATAGCTAGTTATTTGGGATTGG - Intronic
1101084969 12:101226430-101226452 CTTTGTGAGCTATATGTGAAGGG + Intergenic
1103588104 12:121971165-121971187 CTCACTGAGCTTGTTGGGATTGG + Intronic
1109379939 13:61545929-61545951 CTTAGAGAGTTATTGTGGATAGG + Intergenic
1112462675 13:99616619-99616641 CTTAGTTAGGTCTTTGAGATTGG + Intronic
1114648870 14:24270793-24270815 CTAAGGGAGCTACTTGGGGTCGG + Intronic
1125442123 15:39714504-39714526 ATTAGAGAGGTATTAGGGATTGG - Intronic
1139066178 16:63317816-63317838 CTTGGTGAGCTCCTTGGCATTGG + Intergenic
1149431811 17:56600224-56600246 GTGAGTGAGCAATTTGGGAAGGG + Intergenic
1155458016 18:26041882-26041904 GTAATTGAGCTCTTTGGGATTGG - Intronic
1157380999 18:47217369-47217391 CTTAATGAACTATATGGGATGGG + Intronic
1164424951 19:28133019-28133041 CTTAGTGTGGGATTTGGAATGGG + Intergenic
1167830800 19:52020685-52020707 CTTAGTGCGCTTTTTGGCATGGG + Intronic
1168551655 19:57301455-57301477 CTTAGTGTGCTAGTTGAGAAGGG + Intergenic
925452287 2:3979948-3979970 CATCGTGAGCTATTTAGGACAGG + Intergenic
925824907 2:7838434-7838456 CTTTTTGAGCTCTTTAGGATGGG - Intergenic
928641551 2:33304696-33304718 CTTAGTGAGGGATTGGGGAAAGG - Intronic
928658718 2:33479424-33479446 CTAAGCCAGCTATTTGGGGTGGG - Intronic
934050837 2:88209510-88209532 CTTGGTGAGCTATTGGAGAGAGG - Intergenic
940089474 2:149899490-149899512 CTTAGTGATTTATCTGGGATTGG - Intergenic
940186283 2:150987310-150987332 CTTAGTGTGCCAGTTGGGAAGGG - Intergenic
941800461 2:169653533-169653555 ATTAGTGAGCAGTTTGGTATGGG - Intronic
947768369 2:232651861-232651883 CTTTGTGAACTATTTTGGAGGGG + Intronic
1168940430 20:1706841-1706863 CATTTTGAGCTATTAGGGATTGG - Intergenic
1179276717 21:39898608-39898630 TATAGTAAGCTGTTTGGGATGGG - Intronic
1180103821 21:45604479-45604501 TTTAGTGTGCCATTTGGGAAGGG + Intergenic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
949729543 3:7092723-7092745 CTCACTGAGATATTTGGGGTTGG + Intronic
955615559 3:60803390-60803412 TTTTGTGAGCATTTTGGGATGGG + Intronic
959455986 3:106562336-106562358 CCTTGTGAGCTATTTGGGGACGG + Intergenic
959768159 3:110058835-110058857 CTTGGTTAGGTATTAGGGATAGG + Intergenic
960669777 3:120144925-120144947 CTCAGTAAGCCACTTGGGATGGG - Intergenic
963878949 3:150505615-150505637 CTTAGTGTGCTGATTGGGAAGGG - Intergenic
968672498 4:1859228-1859250 CTTAGGGACCTAGTTGGGGTTGG + Intergenic
970260076 4:14215359-14215381 GTTAGTGATCTGTTTTGGATGGG - Intergenic
970871124 4:20818203-20818225 TTTACTTAGCTATTTGGTATTGG - Intronic
970929208 4:21489525-21489547 GCTAGTGAGCTATTTATGATGGG - Intronic
979228039 4:118312833-118312855 TCTAGTGAGCTATTTGGGATAGG - Intronic
979898444 4:126189379-126189401 CTTAGTGGGCTATTTGATTTTGG - Intergenic
982350551 4:154409979-154410001 CTTAGTGTGCCAGTTGGGAAGGG - Intronic
983518446 4:168680538-168680560 CTTAATGTGGTATTTGGGAATGG + Intronic
984288701 4:177765774-177765796 CTTAGTGAGCTATTTGGGATAGG + Intronic
985769154 5:1798169-1798191 TTTTGTGAGGCATTTGGGATGGG - Intergenic
986531559 5:8741804-8741826 CTTAATGAGCTATATGACATTGG + Intergenic
987036062 5:14019473-14019495 CTTAATGTGCTATATGTGATGGG + Intergenic
987199716 5:15563789-15563811 CTTAGGGAATTATTTGGGGTTGG + Intronic
990218081 5:53556606-53556628 CTTGGTGAGATATTGGGGACAGG - Intergenic
997771109 5:136555469-136555491 CTTAGTGTGCTGGTTGGGAAGGG + Intergenic
997778794 5:136636485-136636507 ATTAGTAAGCTAGTAGGGATTGG + Intergenic
998156891 5:139792218-139792240 CTTATTGAGCTCTCTGGGATTGG + Intergenic
1000884537 5:166736148-166736170 CTTTTTGAGTTATGTGGGATGGG + Intergenic
1002365149 5:178704131-178704153 CTGTGTGAATTATTTGGGATTGG - Intergenic
1002551925 5:180001052-180001074 CTTAGTGTGCCAGTTGGGAAGGG + Intronic
1003460903 6:6327075-6327097 CAAAGTGAGATACTTGGGATGGG - Intergenic
1003716137 6:8648274-8648296 CTTAGTGAGCATTGAGGGATGGG - Intergenic
1003855633 6:10271111-10271133 CTTTCTCAGCTTTTTGGGATGGG - Intergenic
1004533918 6:16480974-16480996 CCTGGTGTGTTATTTGGGATGGG - Intronic
1015857069 6:137636123-137636145 CTTAGTGAGGTAATTCTGATTGG - Intergenic
1025502346 7:61319999-61320021 CTCAGGGAGATATTTGTGATTGG - Intergenic
1025517214 7:61666221-61666243 CTCAGGGAGATATTTGTGATTGG - Intergenic
1025541550 7:62095045-62095067 CTCAGGGAGATATTTGTGATTGG - Intergenic
1028353649 7:89880393-89880415 CTTAGAGTGCTTTTTGGGATGGG - Intergenic
1031308065 7:120159289-120159311 CATAGTACTCTATTTGGGATGGG + Intergenic
1031856620 7:126930116-126930138 CTTACTGAGCTATATTAGATAGG + Intronic
1037085862 8:14849319-14849341 CTTGGTGAGATATCTGGGAGTGG - Intronic
1039575268 8:38618476-38618498 ATGAGTCAGCTATTTGGGTTGGG - Intergenic
1039970950 8:42321260-42321282 CTTTGTCAGGTATTTGGCATTGG + Intronic
1041698493 8:60762457-60762479 CTTAGTGAGCTGTGTGGCCTGGG + Intronic
1042859944 8:73302231-73302253 CTTAGTGATAGATTTGGGGTAGG + Intronic
1046763843 8:118048413-118048435 CTTAGAGACCTATCTGGCATAGG - Intronic
1048198180 8:132350104-132350126 CTAAGTGTGCCATTTGGGAGTGG - Intronic
1048804500 8:138227283-138227305 CAAAGTCAGCTATTTGGGAGTGG + Intronic
1050447550 9:5741101-5741123 CTTGGTGTGCTGTTTTGGATTGG + Intronic
1052186388 9:25601355-25601377 CTGAGTGACATATTTGAGATAGG + Intergenic
1053140051 9:35676468-35676490 CTGAGTGAGCTTGCTGGGATGGG - Intronic
1057431364 9:94997436-94997458 CATAGTAACCTATTTGAGATGGG + Intronic
1186009975 X:5119162-5119184 CTTAGTGAGCACATGGGGATTGG - Intergenic
1188072188 X:25730330-25730352 CCTACTGGGCTATTTTGGATTGG - Intergenic
1196986284 X:121275846-121275868 TATAGAGAACTATTTGGGATAGG - Intergenic
1200039493 X:153355321-153355343 CTTATTGAGCTGTTTGTCATTGG + Intronic