ID: 984289251

View in Genome Browser
Species Human (GRCh38)
Location 4:177772520-177772542
Sequence TACTCTTACGAGTCTAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 41}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984289251_984289255 28 Left 984289251 4:177772520-177772542 CCTGCCCTAGACTCGTAAGAGTA 0: 1
1: 0
2: 1
3: 4
4: 41
Right 984289255 4:177772571-177772593 AATACAGACTTTTTTATACTTGG 0: 1
1: 0
2: 3
3: 33
4: 335
984289251_984289256 29 Left 984289251 4:177772520-177772542 CCTGCCCTAGACTCGTAAGAGTA 0: 1
1: 0
2: 1
3: 4
4: 41
Right 984289256 4:177772572-177772594 ATACAGACTTTTTTATACTTGGG 0: 1
1: 0
2: 2
3: 34
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984289251 Original CRISPR TACTCTTACGAGTCTAGGGC AGG (reversed) Intronic
901011109 1:6202673-6202695 TACTCTTGCGAGGCTGAGGCAGG - Intronic
903102475 1:21043760-21043782 TACTCTCAGGAGGCTAAGGCAGG + Intronic
906609947 1:47194566-47194588 TGCTCTTACATGTCTAGGGAAGG - Intergenic
910585456 1:88874246-88874268 CACTCTTAAGAGTCTAGGTCAGG - Intronic
912239024 1:107885640-107885662 TACTGTTACAAGTCAAGGGCAGG - Intronic
921195783 1:212756521-212756543 TAATCTTAAGAGTCAGGGGCTGG + Intronic
923077080 1:230619363-230619385 TACTTTTACTTGTCTAGTGCTGG - Intergenic
1071518640 10:86315449-86315471 TCCTCTAATGAGTCCAGGGCTGG + Intronic
1077910877 11:6570553-6570575 TACTCTCTCGAGTCTAGGGTGGG + Intronic
1100688666 12:97014628-97014650 TAGTTTTACCAGTATAGGGCTGG + Intergenic
1101374100 12:104156127-104156149 AATTCTTACCTGTCTAGGGCAGG + Intergenic
1102762585 12:115401367-115401389 GACTCTTAAGAGTCTCTGGCAGG - Intergenic
1103633165 12:122279729-122279751 TCCTCTTCAGAGTCTATGGCTGG - Intronic
1110387501 13:74931108-74931130 TACCCTTCTGAGTCTATGGCTGG - Intergenic
1110657882 13:78022195-78022217 TGCACTTAAGAGTTTAGGGCAGG + Intergenic
1118669200 14:68103531-68103553 TACTCTTACGAATATAGTGTGGG + Intronic
1121107807 14:91292533-91292555 TTCACCTACGTGTCTAGGGCTGG - Intronic
1127598676 15:60513019-60513041 TAGTTATAAGAGTCTAGGGCAGG + Intronic
1127839349 15:62817553-62817575 TACACTGCCGTGTCTAGGGCTGG + Intronic
1159604542 18:70461486-70461508 CACTTTTGCGAGTCCAGGGCAGG - Intergenic
1165014942 19:32874027-32874049 TACTCTTGGGAGGCTGGGGCAGG + Intergenic
1166269393 19:41704631-41704653 AACTCTTAAGAGCCTGGGGCCGG - Intronic
945282640 2:208050425-208050447 TACTCTTACTAGACTTGGGATGG + Intergenic
1172132629 20:32665525-32665547 TGCTCTTCCCAGTCTTGGGCAGG - Intergenic
1173048759 20:39538446-39538468 AACTCTTATAAGTCTGGGGCTGG + Intergenic
1177821119 21:26031854-26031876 TCCACTTACGAATCTGGGGCAGG - Intronic
1179110098 21:38438909-38438931 GTCTCTTCCGATTCTAGGGCAGG + Intronic
955479272 3:59372807-59372829 TACTCTTAAGCATCTAGGACAGG - Intergenic
958594363 3:96202057-96202079 TACTGTTACCAGGCTAGGGAAGG + Intergenic
979874678 4:125873033-125873055 TACTCTTATGAGTCTAGGACAGG - Intergenic
979893355 4:126129027-126129049 TACTCTTCTCAGTCTAGGGATGG + Intergenic
984289251 4:177772520-177772542 TACTCTTACGAGTCTAGGGCAGG - Intronic
993071018 5:83163625-83163647 AACTCCTACGAGTCTATGACAGG + Intronic
993356752 5:86922357-86922379 TCCTCTTATGAGTCTTTGGCAGG + Intergenic
995952575 5:117733702-117733724 TACTCTCAGGAGACTAAGGCAGG + Intergenic
1007198154 6:40081158-40081180 TGCTCAAATGAGTCTAGGGCAGG + Intergenic
1019348686 7:543133-543155 GACTCTGACGAGGCCAGGGCAGG + Intergenic
1022766694 7:33420500-33420522 TACTGTTACGAGGTTTGGGCAGG + Intronic
1024632820 7:51263241-51263263 TGCTCATAGGAGCCTAGGGCTGG - Intronic
1026291361 7:69009206-69009228 TACTTTTAGGAGTCTAGGGAAGG - Intergenic
1029809361 7:103032437-103032459 TACTATTAAGTGTCTAAGGCAGG - Intronic
1033397521 7:140989979-140990001 TTCTCTTCCAAGTCTTGGGCCGG + Intergenic
1045986597 8:108256445-108256467 TACTCCTGGGAGTCTAGGGGAGG + Intronic
1052243205 9:26300429-26300451 TTGTCTTAAGAGTCTTGGGCAGG - Intergenic
1058163879 9:101598705-101598727 TACACTTAGGTGTCCAGGGCAGG - Intronic
1190228111 X:48561068-48561090 TGCTCCAACAAGTCTAGGGCTGG - Exonic
1199732282 X:150647404-150647426 TCCTCTTAGGAGTCGAGGGAAGG + Intronic