ID: 984289780

View in Genome Browser
Species Human (GRCh38)
Location 4:177781123-177781145
Sequence AATAACTAAAAGAGTATAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4231
Summary {0: 12, 1: 486, 2: 1010, 3: 1275, 4: 1448}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984289778_984289780 30 Left 984289778 4:177781070-177781092 CCTAGTATTTGATAGCACAATAG 0: 45
1: 440
2: 1034
3: 1076
4: 909
Right 984289780 4:177781123-177781145 AATAACTAAAAGAGTATAAGTGG 0: 12
1: 486
2: 1010
3: 1275
4: 1448

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984289780 Original CRISPR AATAACTAAAAGAGTATAAG TGG Intronic
Too many off-targets to display for this crispr