ID: 984291513

View in Genome Browser
Species Human (GRCh38)
Location 4:177801005-177801027
Sequence GAGCAGTAGTTACCAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 949
Summary {0: 1, 1: 1, 2: 11, 3: 136, 4: 800}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984291513_984291515 -6 Left 984291513 4:177801005-177801027 CCATCCTCTGGTAACTACTGCTC 0: 1
1: 1
2: 11
3: 136
4: 800
Right 984291515 4:177801022-177801044 CTGCTCTACTCTCTACTTCCAGG 0: 1
1: 0
2: 8
3: 43
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984291513 Original CRISPR GAGCAGTAGTTACCAGAGGA TGG (reversed) Intronic
904472348 1:30743718-30743740 GAGCATGAGTTACCAGTGCAGGG - Intronic
904882273 1:33709982-33710004 GAGAAGCAGTTTCCAGAGGAGGG - Intronic
904961667 1:34338189-34338211 CAGCAGTGGTGACCAGAGGAAGG - Intergenic
905050056 1:35042883-35042905 GAGTAATGGTTACCAGAGGATGG + Intergenic
905116793 1:35648368-35648390 GATCTGTAGTTGCCAGGGGAGGG + Intergenic
905919628 1:41710795-41710817 CAGCAGTGGTCACCATAGGATGG + Intronic
906284131 1:44575189-44575211 GAGTGATAGTTACCAGAGGCTGG - Intronic
906391057 1:45416757-45416779 GAATGGTGGTTACCAGAGGATGG - Intronic
906816261 1:48882783-48882805 GAACAGTAGTTGCCAGAGGCTGG - Intronic
906986912 1:50692469-50692491 GAACAGTGATTACCAGAGGCTGG - Intronic
907655931 1:56341954-56341976 GAACAGTAGTTACCAGAGGATGG + Intergenic
908166698 1:61466018-61466040 GAACAGTGGTGACCAGAGGCAGG + Intergenic
908375296 1:63531197-63531219 GATCAGTGGTTACCAGAGACTGG - Intronic
908568848 1:65387467-65387489 GATCAGTGGTTACCAGGAGATGG - Intronic
908604840 1:65785731-65785753 GATTGGTAGTTACCAGAGGCTGG + Intergenic
908813505 1:68008594-68008616 GAGCAGTAGTTCCCCCAGCATGG - Intergenic
909029248 1:70520118-70520140 GAATAGTGGTTACCAGAGGCCGG + Intergenic
909163251 1:72181858-72181880 AAACAGCAGTTACCAGAGGTTGG + Intronic
909257509 1:73442971-73442993 GAGTAGTGGCTACCAGAGGTGGG - Intergenic
909390254 1:75112233-75112255 GAGCAGTAGTTCCCCCAGCACGG - Intergenic
909475115 1:76073634-76073656 GAGCAGGAGTAACCACAGGAAGG - Intergenic
909922058 1:81394379-81394401 GAATAGTGGTTACCAGAGGCTGG - Intronic
910570336 1:88694291-88694313 GATCAGTGGTTGCCAGGGGATGG - Intronic
910611718 1:89151217-89151239 GAACAGTGGTTACCAGGGCATGG - Intronic
910625357 1:89301340-89301362 GAGTAGTGGTTACCAGAGCATGG - Intergenic
911082254 1:93944782-93944804 GAACAGTAGTTACCATAGCCTGG - Intergenic
911162642 1:94696965-94696987 GAACAGTGGTTACCAGAGACTGG + Intergenic
911388297 1:97205334-97205356 GATCAGTGGTTGCCAGGGGATGG - Intronic
912583473 1:110740169-110740191 GAACAGTGGTTACCAGAGACTGG + Intergenic
912610467 1:111037576-111037598 GAAGAATAGTTACCAGAGGCTGG + Intergenic
912749572 1:112275090-112275112 GAGCAGTAATTATCAGAGCTTGG + Intergenic
912882395 1:113429274-113429296 GAGCTATTGTTACCAGTGGAGGG + Intronic
913028039 1:114865850-114865872 GATCAGTGGTTACCAGAGTAGGG - Intronic
913313654 1:117531031-117531053 GACCAGTGGTTACCAGTGGCTGG - Intergenic
913381171 1:118211893-118211915 GAACAATGGTTACCAGAGGATGG - Intergenic
914696605 1:150088237-150088259 GAATAGCAGTTACCAGAGGATGG - Intronic
914744134 1:150488818-150488840 GAGTGATAGTTACCAGAGGCTGG - Intronic
914928870 1:151911880-151911902 GAGGTGTAGTTGCCATAGGATGG + Intergenic
915179621 1:154047077-154047099 GAACAATGGTTACCAGAGGCTGG + Intronic
915594926 1:156891455-156891477 GAGTAGTGGTTACCAGGGGCTGG + Intergenic
916371200 1:164096606-164096628 AATCAGTGGTTACCTGAGGATGG + Intergenic
916509482 1:165459246-165459268 AAACAGTGGTTACCAGAGGTGGG + Intergenic
916863699 1:168833785-168833807 AAGCACTGGCTACCAGAGGAGGG - Intergenic
916975909 1:170077727-170077749 GATCAGTATTTACCAGAGCCTGG - Intronic
917303811 1:173606594-173606616 GAGCAGTAGTTCTCAAAGGCTGG + Intergenic
917547135 1:175982849-175982871 GAATGGTAGTTACCAGAGGTGGG + Intronic
917658654 1:177155178-177155200 GAGCAGTGGTTGCCAGAGTTTGG + Intronic
917951828 1:180046246-180046268 GATTAGTGGTTGCCAGAGGAGGG - Intronic
918155216 1:181838351-181838373 GAACAGTGGTTACCAGAGGATGG + Intergenic
918388822 1:184037313-184037335 GAGCAGTAGCGACCAGGCGAGGG + Exonic
918475721 1:184922405-184922427 GAACAGTAGTTACCAGAGGCTGG - Intronic
918502074 1:185208331-185208353 GAATAGTGATTACCAGAGGATGG + Intronic
918596054 1:186294491-186294513 GAGAAGTAGTTCCCAGAAAAGGG + Intergenic
918674641 1:187267889-187267911 CAGCATTTGTTACCAGAGAAAGG - Intergenic
918892363 1:190292120-190292142 GACTGGTAGCTACCAGAGGATGG + Intronic
918998994 1:191803602-191803624 GAATGGTAGTTACCAGAGGTTGG - Intergenic
919007516 1:191917554-191917576 GAATGGTGGTTACCAGAGGATGG - Intergenic
919192314 1:194238119-194238141 GAATGGTAGTTACTAGAGGATGG + Intergenic
919284200 1:195532525-195532547 GAATAATAGTTACCAGAGGATGG + Intergenic
919962119 1:202481895-202481917 GAACAGTGGTTACCAGAGACTGG - Intronic
920025741 1:202994204-202994226 GAATAGTGGTTACCACAGGACGG - Intergenic
920148662 1:203885495-203885517 GAACAGCAGTTACCAGGGGCAGG - Intergenic
920608521 1:207413985-207414007 GAGTAGAGGTTACCAGGGGATGG - Intergenic
920757358 1:208746253-208746275 GAACGGTGGTTACCAGAGGCTGG - Intergenic
921587750 1:216967402-216967424 GATCAGTGGTTGCCAGAGGTTGG - Intronic
922167215 1:223126321-223126343 GAGCAGAAGTTACCAGGGGCTGG + Intronic
922373654 1:224939003-224939025 GAATGGTAGTTACCAGAGGCCGG + Intronic
922392561 1:225160521-225160543 GACCAGGAGTTATGAGAGGATGG + Intronic
922547871 1:226472210-226472232 GATCAGTGGTTACCCGAGGATGG + Intergenic
923411249 1:233711975-233711997 GAGCATTAGTTTCCAGATGCTGG + Intergenic
923546628 1:234928052-234928074 GAGCAGTAGTGTTCTGAGGAAGG - Intergenic
923763802 1:236873253-236873275 GAGTAGAGGTTACCAGGGGATGG + Intronic
924350848 1:243113235-243113257 GAGTGGTGGTTACCAGAGGCTGG + Intergenic
1063222643 10:3984953-3984975 GAACAGTGGTCACCAGAGGCTGG + Intergenic
1063248496 10:4248769-4248791 GAGCAGAAGCCAACAGAGGACGG - Intergenic
1063644355 10:7864251-7864273 GATCAGTAGTTGCCACAGGTTGG - Intronic
1063735177 10:8745318-8745340 GAATATTAGTTACCAGAGGCTGG - Intergenic
1063783963 10:9359018-9359040 GAATAGTAGTTACCAGAGAATGG - Intergenic
1063921081 10:10933612-10933634 GAATAGTGGTTACCAGGGGATGG - Intergenic
1064361893 10:14673303-14673325 GAACAGTGGTTACCAGAGGCTGG - Intronic
1064419045 10:15174470-15174492 GAGCAGTGGTTACTAGAGCTAGG - Intergenic
1064476223 10:15691675-15691697 GAATGGTAGTTACCAGAGGCTGG + Intronic
1064597139 10:16957205-16957227 GAATAGTGGTTACCAGAGGCTGG - Intronic
1064757574 10:18585621-18585643 GAATAGTGGTTACCAGAGGCTGG + Intronic
1064797445 10:19029144-19029166 GAGTAGTGGTTACTAGAGGTGGG + Intergenic
1064803591 10:19105181-19105203 GAATAGTGGTTACCAGAGGCTGG - Intronic
1064809681 10:19181523-19181545 AAACAGTGGTTACCAGAGGCAGG + Intronic
1064822583 10:19354539-19354561 GAATGGTAGTTACCAGAGGCTGG - Intronic
1065265426 10:23970458-23970480 GAGCAGTGGTTACCAGGAGCTGG + Intronic
1065412874 10:25449574-25449596 GAACAGTGGTTACCAGGGGTAGG + Intronic
1065629698 10:27665938-27665960 GAACAGTAGTTACCAGAGACTGG + Intergenic
1065949151 10:30636133-30636155 GAGCAGTGGGTACCAGAGCTGGG - Intergenic
1066043229 10:31573585-31573607 GAGCAGTGGTTGCCAGGGGTAGG + Intergenic
1066438420 10:35415072-35415094 GATCAGTAGTTTCCTGAGGATGG + Intronic
1066565500 10:36717717-36717739 GAATAGTGGTTACTAGAGGATGG + Intergenic
1067827214 10:49585559-49585581 GAAAAGTGGTTACCAGAGGATGG + Intergenic
1068100668 10:52548674-52548696 GATCAGTGGTTGCCAGTGGATGG - Intergenic
1068370487 10:56107144-56107166 GAATAGTGGTTACCAGAGGAAGG + Intergenic
1068472050 10:57477847-57477869 GGGCAGTAGTTGGCAGAAGATGG - Intergenic
1068553638 10:58433797-58433819 GAACAGTGGTTGCCAGGGGATGG - Intergenic
1069076147 10:64040527-64040549 GAATAGTGGTTACCAAAGGATGG - Intergenic
1069077037 10:64049120-64049142 GAATGGTAGTTATCAGAGGATGG + Intergenic
1070566773 10:77609419-77609441 GAACAGTGGTTACCAGGGGCTGG + Intronic
1070585440 10:77762476-77762498 GATTAGTGGTTACCAGAGGCTGG - Intergenic
1070595727 10:77831668-77831690 GTGCATAAGTTAACAGAGGAAGG + Intronic
1071679200 10:87687548-87687570 GAATAGTGGTTACCAGAGGCTGG + Intronic
1071888341 10:89975055-89975077 GAGCAGCATTTTCCAGAGTATGG + Intergenic
1072050199 10:91696525-91696547 GGATAGTAGTTACCAGAGGCTGG + Intergenic
1072496318 10:95963635-95963657 GAGGAGGAGAAACCAGAGGAGGG + Intronic
1072726972 10:97820343-97820365 GATGAGTGGTTACCAGAGGCTGG - Intergenic
1073132583 10:101199553-101199575 GAGCAATAGTCACCAGAGGCTGG + Intergenic
1073272864 10:102280984-102281006 GAGCAGGAGTTGGCAGGGGATGG + Intronic
1073658091 10:105439453-105439475 GAGTAGTAGTTGCCAGGGGCTGG - Intergenic
1073723943 10:106208209-106208231 GATCAGTAGTTGCCAGAGGTTGG - Intergenic
1073851490 10:107624124-107624146 GAATAGTAGTTACCAAAGGCTGG - Intergenic
1074181306 10:111066879-111066901 GAGCAGAAGATACTAGAGGTTGG + Intergenic
1074302336 10:112243883-112243905 GATTGGTAGTTGCCAGAGGATGG + Intergenic
1074638263 10:115345764-115345786 GAGCAGTGGTTGCCAGGGGCTGG - Intronic
1074836007 10:117294832-117294854 GAAGAGTGGTTACCAGAGGCTGG + Intronic
1075229020 10:120656348-120656370 GATCAGTGGTTACCTGAGAATGG - Intergenic
1075317205 10:121462441-121462463 GAGCATAAGTTTCCTGAGGAGGG + Intergenic
1075628967 10:123988213-123988235 GAATAGAAGTTACCAGAGGGTGG - Intergenic
1075959659 10:126557534-126557556 GGGCAGTGTTTACCTGAGGAGGG - Intronic
1076212940 10:128664930-128664952 GAGTAGAAGTTACCAGAGGCTGG + Intergenic
1077258658 11:1603520-1603542 GAACAGTAGTTACCAGGGTCTGG + Intergenic
1077928990 11:6710880-6710902 GAACAGTGGTTACTAGAGGCTGG - Intergenic
1078058290 11:8025515-8025537 GATCAGTGGTTCCCTGAGGATGG - Intronic
1078267139 11:9763935-9763957 GGGCAGTGGTTCTCAGAGGACGG - Intergenic
1078503840 11:11913586-11913608 GAATGGTAGTTACCAGAGGCTGG + Intronic
1079247456 11:18763172-18763194 AAGCAGGACTTCCCAGAGGAAGG + Intronic
1079456896 11:20644249-20644271 GAATGGTAGTTACCAGAGGTTGG - Intronic
1079679757 11:23280417-23280439 GTGCAGTGGTTGCCAGATGAAGG - Intergenic
1079707811 11:23642569-23642591 GAGGAATGGTTACCAGAGGCTGG + Intergenic
1080279367 11:30539092-30539114 GAGGAGTAGTTTCCTGAGGGTGG - Intronic
1081133608 11:39410469-39410491 GAAAGGTAGTTACCAGAGGCTGG + Intergenic
1081143028 11:39527220-39527242 GAATAGTAGTTACCAGGGGCTGG - Intergenic
1081902221 11:46638601-46638623 GAATAGGAGTTACCAGAGGATGG - Intronic
1082107781 11:48239433-48239455 GATCAGTAGCTGCCTGAGGAGGG - Intergenic
1082864946 11:57890093-57890115 GAACAGTGGTTACCAGAGACTGG - Intergenic
1082897578 11:58208810-58208832 GAACAGTTGTTACCAGAGACTGG + Intergenic
1082927216 11:58562677-58562699 GAGGAGAAGTTACCAGAGCTAGG + Intronic
1083016284 11:59457580-59457602 GAGCAGGAGGAACCAGAGCAGGG - Exonic
1084081736 11:66831563-66831585 GGTCAGTGGTTACTAGAGGATGG + Intronic
1084842872 11:71871350-71871372 GAACAGTGGTTACCAGAGCCTGG + Intronic
1084949028 11:72654549-72654571 GAGCAGTGGTGGCCGGAGGAGGG - Intronic
1085440571 11:76558930-76558952 GAGCAGAAGTAGCCAGAGGATGG + Intergenic
1085446558 11:76604691-76604713 GAGTAATTGTTACCAGAGGTAGG - Intergenic
1085827311 11:79861348-79861370 GACCAGTAGTTAGCAGAGAAAGG + Intergenic
1086340034 11:85839418-85839440 GAAGGATAGTTACCAGAGGATGG + Intergenic
1086528501 11:87756839-87756861 AAGCAGGAGTGAGCAGAGGAAGG - Intergenic
1086546840 11:88006823-88006845 GAATAGTGGTTATCAGAGGATGG + Intergenic
1086609216 11:88733984-88734006 GAACAGTATTTACCAAAGTATGG + Intronic
1087100538 11:94359483-94359505 GAGACGAAGTTTCCAGAGGAAGG + Intergenic
1087326283 11:96727484-96727506 GGGAAGAAGTTTCCAGAGGAAGG - Intergenic
1087342482 11:96925020-96925042 GAACAGTGGTTACCAGAGGTTGG + Intergenic
1087343840 11:96943731-96943753 GATCAGTAGTTAGCAGAGTCTGG - Intergenic
1087695216 11:101369166-101369188 GAGATGAAGTTTCCAGAGGAAGG - Intergenic
1087955572 11:104282808-104282830 GAATAATGGTTACCAGAGGATGG - Intergenic
1088410337 11:109526969-109526991 GAGCAATAGATACCAGAGACAGG + Intergenic
1088432261 11:109771623-109771645 GAATAGTAGTTAACAGAGGACGG - Intergenic
1088502854 11:110500116-110500138 GAACAGTGGTTACCAGAGGCTGG - Intergenic
1088541248 11:110916052-110916074 GAAGGGTAGTTACCAGGGGATGG + Intergenic
1088821253 11:113459614-113459636 TAGTAGTAGTTACCAGAGGCTGG + Intronic
1088829747 11:113525335-113525357 CAATAGTGGTTACCAGAGGATGG + Intergenic
1090734998 11:129604846-129604868 GGGCAGAAGTTACTAGAGTATGG + Intergenic
1090796671 11:130141408-130141430 AAGCAGCAGGTAGCAGAGGAAGG + Intronic
1090832551 11:130429144-130429166 GTGCAGTAGTGATGAGAGGAGGG - Intergenic
1090919453 11:131195252-131195274 GAGGAGTACCTACCACAGGACGG - Intergenic
1091827770 12:3526040-3526062 GAACAGTAGTTGCCAGGGGCTGG - Intronic
1092644789 12:10558593-10558615 GAGTGGTAGTTACCAGGGGTTGG - Intergenic
1093072453 12:14721093-14721115 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1093307062 12:17533653-17533675 GAACGATAGTTACCAGAGGCTGG - Intergenic
1093760788 12:22907144-22907166 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1094091036 12:26650259-26650281 GATCAGCAGTTGCCAGGGGATGG + Intronic
1094126205 12:27024504-27024526 AAGGAGTAGTTCCCTGAGGAAGG - Intronic
1095235963 12:39796052-39796074 GATTAGTAGTTGCCAGAGGCTGG - Intronic
1096296159 12:50385945-50385967 GAACAGTGGTTAGCAGAGGCTGG + Intronic
1096646113 12:53037052-53037074 GAGCAGTGGTTACTAGAGTTTGG + Intronic
1097094733 12:56537362-56537384 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1097437131 12:59563711-59563733 TATCAGTAGTTTCCAGGGGAAGG + Intergenic
1097569232 12:61311080-61311102 GAGGAATGGTTACCAGAGGTTGG + Intergenic
1097746298 12:63307286-63307308 GAAAGGTGGTTACCAGAGGATGG + Intergenic
1097819880 12:64117769-64117791 GAACGGTAGTTGCCAGAGGCTGG - Intronic
1098238921 12:68446107-68446129 GAACAGAGGTTACCAGAGGCTGG + Intergenic
1099100359 12:78432281-78432303 GATTAGTGGTTACCAGAGGCTGG - Intergenic
1099233181 12:80051089-80051111 GAGTGATAGTTACCAGAGGTAGG - Intergenic
1099348479 12:81534139-81534161 GAATGGTAGTTACCAGAGGCTGG + Intronic
1099431609 12:82592538-82592560 GAATAGTGGTTACTAGAGGATGG - Intergenic
1099749834 12:86759055-86759077 TAACAGTGGTTACCAGAGGTAGG - Intronic
1099993766 12:89754301-89754323 GAATAGTAGTTACCAGAGGATGG + Intergenic
1100859447 12:98788714-98788736 GAGCAGTAGTTCTCAAAGTATGG - Intronic
1100885973 12:99070518-99070540 CAGCTGTAATAACCAGAGGATGG + Intronic
1100930644 12:99605500-99605522 GAATAGTTGTTACCAGAGGTTGG - Intronic
1101776123 12:107795637-107795659 TAGCAGTGGTTATCAGAGGTTGG + Intergenic
1102204080 12:111078333-111078355 GAGAGGAAGTTACCAGAGAAAGG + Intronic
1103071040 12:117942397-117942419 GAGTGGTGGTTACCAGAGGCTGG - Intronic
1103840248 12:123857877-123857899 GAGCAGAGGTTGCCAGCGGAGGG - Intronic
1104136197 12:125941302-125941324 GAAGAGTAGTTACCAGAGGCTGG + Intergenic
1104218150 12:126755336-126755358 GAACAGGAGTTACAAGTGGATGG - Intergenic
1104321085 12:127751495-127751517 GAACAGTGGTTACCAGGGGCTGG - Intergenic
1104605161 12:130182810-130182832 GAGCTGTGGTAAACAGAGGAGGG - Intergenic
1104849127 12:131862905-131862927 GAGCAGTGGTTGCCAGCGGGTGG - Intergenic
1105201413 13:18182796-18182818 GAGCAGTGGTTCCCACAGAATGG + Intergenic
1105727290 13:23177194-23177216 GAGCAATGATTACCAGAGAATGG + Intergenic
1105816958 13:24044867-24044889 GAACGGTGGTTTCCAGAGGAGGG + Intronic
1106819490 13:33448278-33448300 GAATAGTGGTTACCAGAGGATGG - Intergenic
1106859477 13:33889727-33889749 GAATAGTGGTTACCAGAGGCTGG - Intronic
1106998723 13:35519933-35519955 GAGTAATAGTTACCAGAGGATGG - Intronic
1107010241 13:35663283-35663305 GAATAGTGGTTACCAGAGGCTGG - Intronic
1107092754 13:36500110-36500132 GAGCAGTTGTTGCCTGAGGATGG - Intergenic
1107221828 13:37990929-37990951 GAATAGTGATTACCAGAGGATGG - Intergenic
1107543842 13:41418249-41418271 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1108015651 13:46072807-46072829 GAGCAGCAGTTAATAGAGAAAGG - Intronic
1108134087 13:47336411-47336433 GAATAGTAGTTACCAGAGGCTGG + Intergenic
1108444032 13:50488085-50488107 GATCAGCAGTTAGCAGAGGCTGG - Intronic
1109212885 13:59555265-59555287 GAATAGCAGTTACGAGAGGATGG + Intergenic
1109333452 13:60960988-60961010 GAACAGTAGTTACCAGAGGCAGG - Intergenic
1109475094 13:62870676-62870698 GAGTGGTGGTTACCAGAGGCTGG - Intergenic
1109916615 13:68995648-68995670 AAACAATGGTTACCAGAGGATGG + Intergenic
1110157871 13:72341036-72341058 GATCTGTGGTTACCAGAGGCTGG + Intergenic
1110354370 13:74550221-74550243 TAGTAGTGGTTACTAGAGGAAGG + Intergenic
1110767857 13:79300695-79300717 GAGAAGAAGCTTCCAGAGGAAGG + Intergenic
1111653658 13:91126064-91126086 GAACAGTAGTTACCAAGGGCTGG - Intergenic
1111661161 13:91213681-91213703 GAGCAGTAGTTGGCAGGGGCTGG + Intergenic
1111761092 13:92465935-92465957 GAATGGTGGTTACCAGAGGATGG + Intronic
1111854688 13:93622926-93622948 GAATAGTAGTTAACAGAGGCTGG - Intronic
1112128959 13:96500098-96500120 GATCGGTGGTTGCCAGAGGAAGG - Intronic
1112362212 13:98728535-98728557 GAATGGTGGTTACCAGAGGATGG + Intronic
1113337041 13:109386590-109386612 GAACAGTAGTTGCCTGGGGAAGG + Intergenic
1113923282 13:113926582-113926604 GATCTGTGGTTTCCAGAGGATGG + Intergenic
1115050534 14:29055769-29055791 GAACAGTAGTTACCAGATGCTGG - Intergenic
1115131646 14:30059948-30059970 GAATAGTAGTTACCAGAGTTAGG - Intronic
1115364551 14:32543212-32543234 GAATAGTAGTTACTAGAGGTTGG - Intronic
1115826136 14:37279956-37279978 GAACAATAGCTACCAGAGGCTGG - Intronic
1115995503 14:39191385-39191407 GAATAGTAGTTACCAGAGACTGG - Intergenic
1116228840 14:42189129-42189151 GAATGGTAGTTACCAGAGGGTGG - Intergenic
1116429747 14:44832141-44832163 GATCAGTGGTTACCAGGGGTTGG - Intergenic
1116559334 14:46358731-46358753 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1116636767 14:47406486-47406508 GAGCAGCATTTACCAGGGAAGGG + Intronic
1117268148 14:54112563-54112585 GAACAGAAGATACTAGAGGATGG + Intergenic
1117419001 14:55524985-55525007 GATCAGTGGCTACCAGAGGCTGG + Intergenic
1117454524 14:55884100-55884122 GAGCAGAAGCTGCCAGAGGAAGG - Intergenic
1117994251 14:61463740-61463762 GAATAGTGGTTACCAGAGGCTGG - Intronic
1118106187 14:62662589-62662611 GAACAGTGGTTACCCGAGGCTGG + Intergenic
1118398544 14:65358012-65358034 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1119314748 14:73683633-73683655 GAACAGTAGTTACCAGAGACTGG - Intronic
1119595690 14:75931306-75931328 GAACAGGAGGGACCAGAGGAGGG - Intronic
1119811533 14:77524825-77524847 GAACAGTGGTTACCAGAGGCTGG + Intronic
1120102814 14:80464588-80464610 CAGCAGCAGTTATCAAAGGATGG - Intergenic
1120413994 14:84195630-84195652 GAGCAAAAGTCACCAGAGGTTGG - Intergenic
1121581041 14:95030915-95030937 GAACAATGGTTACCAGAGGCTGG + Intergenic
1121732204 14:96194619-96194641 GTGCAGTGGAAACCAGAGGATGG + Intergenic
1121920970 14:97881212-97881234 GAACAGTGGTTACTAGAGGCTGG + Intergenic
1122755813 14:103979064-103979086 GAGCAGAAGATACTAGAGGCTGG - Intronic
1123899984 15:24866705-24866727 GAACGGTAGTTACCAGAGCCTGG - Intronic
1124047054 15:26160172-26160194 GCACAGTTGTTACCATAGGAAGG + Intergenic
1124174292 15:27407780-27407802 GAACAGTGGTTGCCAGGGGATGG + Intronic
1124184917 15:27516453-27516475 GAGGAGCAGTTCCCAGAAGATGG - Intronic
1124576674 15:30915276-30915298 GAATAGTGGTTACCAGAGGCTGG + Intronic
1124913938 15:33950183-33950205 GAACAGTGGTTGCCAGAGGCTGG + Intronic
1125060925 15:35422731-35422753 GAATGGTAGTTACCAGAGGATGG - Intronic
1125092448 15:35810275-35810297 GACCAGTAGTAACAAGAGGTTGG + Intergenic
1125542927 15:40481553-40481575 GAGTGGTAGTTGCCAGGGGATGG - Intergenic
1125829010 15:42699333-42699355 GAATAGTGGTTACCAGAGGCTGG - Intronic
1126313738 15:47345808-47345830 AATCAGTGGTTACCTGAGGATGG + Intronic
1127424530 15:58842006-58842028 AAGCAGAAGTTATCAGAGGGTGG - Intronic
1127918381 15:63473964-63473986 GAGCAGTGGTTCTCAGAGCAAGG - Intergenic
1127949067 15:63786727-63786749 GATTAGTAGTTGCCAGAGGCTGG + Intronic
1128141313 15:65302659-65302681 GATTAGTAGTTGCCAGAGGCTGG + Intergenic
1128353268 15:66906214-66906236 GACCAGTAAGTAGCAGAGGAAGG - Intergenic
1128837170 15:70818582-70818604 GACCAGTAGTTGCCAGGGTATGG - Intergenic
1128955345 15:71936289-71936311 GAGCAGTGATTACCAGAGACTGG + Intronic
1129426744 15:75468971-75468993 GAGCAGAAGGTACCTGAAGAAGG + Exonic
1130145099 15:81268062-81268084 GAGAGGGAGTTATCAGAGGAAGG + Intronic
1131216898 15:90545018-90545040 AAACAGTAGTTGCCAGAGGCTGG - Intronic
1131475285 15:92733414-92733436 GATTAGTAATTACTAGAGGATGG + Intronic
1131544462 15:93304378-93304400 GAATGGTAGTTACCAGAGGCTGG - Intergenic
1131703277 15:94964304-94964326 GAACAGTGGTTACCAGAGACTGG + Intergenic
1131875907 15:96806430-96806452 GAATAGTAGGTACCAGAGGCAGG + Intergenic
1132423563 15:101694868-101694890 GAGTGGTGGTTACCAGAGGCTGG + Intronic
1132951426 16:2564478-2564500 GGGCAGTGGTGCCCAGAGGAGGG + Intronic
1132962924 16:2635692-2635714 GGGCAGTGGTGCCCAGAGGAGGG - Intergenic
1133547470 16:6821564-6821586 GACCAGTGGTTACCAGCGGTTGG - Intronic
1133914768 16:10099485-10099507 GAACACTAGTTAGCTGAGGAAGG - Intronic
1133920543 16:10149048-10149070 GTGCAATGGTTACCAGAGGCTGG + Intronic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1134890990 16:17841672-17841694 GAGCAGTAGTAACCAGTGGGTGG + Intergenic
1135388577 16:22068543-22068565 GACTAGTGGTTGCCAGAGGATGG - Intronic
1136647841 16:31637496-31637518 GAGCAGTAGTGGCGAAAGGAAGG - Intergenic
1137068114 16:35872257-35872279 GATCAGAAGTTACCACAGGCTGG + Intergenic
1138085879 16:54133353-54133375 GAACAGTGGTTACCAGCGGTTGG - Intergenic
1138402172 16:56755437-56755459 GATTAGTAGTTGCCAGGGGATGG + Intronic
1138921958 16:61541744-61541766 GAACAGTAGATACCAGAGACTGG + Intergenic
1139189939 16:64850825-64850847 GAACAGTGGTTACCAGAGCCTGG + Intergenic
1139275502 16:65723960-65723982 GAGCAGGGGATACCAGGGGAAGG + Intergenic
1139652032 16:68367197-68367219 GAGCAGTTGTTGCCTGAAGACGG - Intronic
1140643297 16:77002474-77002496 GAGCAGCTGTTAACACAGGAAGG - Intergenic
1141403066 16:83767820-83767842 GATCAGTAGTTGCCAGGGGCTGG + Intronic
1142190953 16:88717107-88717129 GAGCAGTGGGAACCAGATGATGG + Exonic
1142904600 17:3033596-3033618 GAGCAGGAGGAACCTGAGGAAGG - Exonic
1142952686 17:3496555-3496577 GAGGAGGAGTGAGCAGAGGACGG + Intronic
1143069163 17:4276044-4276066 GAGCAGTACTTACCAGGGCAAGG - Intronic
1143113812 17:4569453-4569475 GAGCAGTGGTTGCCAGGGGCTGG + Intergenic
1143312935 17:6008182-6008204 GATCAGTGGTTGCCAGTGGATGG - Intronic
1143809700 17:9461302-9461324 GAGGAGTGGTTTCCAGTGGAGGG + Intronic
1144077232 17:11730146-11730168 CAGCAGCAGTTAGTAGAGGAAGG + Intronic
1146145930 17:30416472-30416494 GTGCAGTAGGAACCACAGGAGGG - Intronic
1146819585 17:35974222-35974244 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1147017248 17:37502086-37502108 CAGCAGTAGTAACTAGAGCAGGG - Intronic
1148943590 17:51238065-51238087 GATCAGTAATTACCTGGGGATGG + Intronic
1148997140 17:51720735-51720757 GAAAGGTAGTTACCAGAGGTTGG + Intronic
1149075147 17:52587751-52587773 GAACAATGGTTACCAGAGGCTGG - Intergenic
1149218684 17:54389343-54389365 GAGCTGTAGACACCAGAGCAGGG + Intergenic
1149283163 17:55130689-55130711 GAATAGTTGTTACCAGAGGCAGG - Intronic
1150045585 17:61910213-61910235 GAATAGAGGTTACCAGAGGATGG + Intronic
1150557138 17:66264537-66264559 GAGCAGTGGTTACTATTGGAGGG + Intergenic
1150949243 17:69783899-69783921 GAACAGCGGTTACCAGAGGATGG + Intergenic
1151045007 17:70909582-70909604 GATCAGTGGTTGCCAGAGGTTGG + Intergenic
1151427819 17:74042545-74042567 ATGCAGTGGTTACCAGAGGAAGG + Intergenic
1152032072 17:77849225-77849247 GAACAGTGGTTCCCAGAGGCTGG - Intergenic
1153149766 18:2078663-2078685 GAATGGTGGTTACCAGAGGATGG + Intergenic
1153426705 18:4973805-4973827 GAATGGTAGTTACCAGAGGCTGG + Intergenic
1153670611 18:7408433-7408455 GAACGGTGGTTACCAGAGGCTGG - Intergenic
1154041630 18:10861576-10861598 GAGGGGTAGTTACCAGAGGCTGG + Intronic
1154075921 18:11201666-11201688 GTTCAGTAGTTACCAGGGGCTGG - Intergenic
1154124223 18:11675328-11675350 GATCAGTAGTTGCCAGGGGTTGG + Intergenic
1154140015 18:11814939-11814961 TAGAAGTGGTTACCAGAGGTTGG + Intronic
1154274903 18:12949898-12949920 GAATAGAGGTTACCAGAGGATGG - Intronic
1155075735 18:22352606-22352628 GAAAAGTGGTTACCAGAGGCTGG - Intergenic
1155481548 18:26293812-26293834 GAACAGTAGCTGCCAGAGGCAGG - Intronic
1156015947 18:32547264-32547286 GAGCAGTAGGTATCAGAGCCGGG - Intergenic
1156081843 18:33345002-33345024 AAGCTGTAGTTACCAAAGTAGGG - Intronic
1156216189 18:35000461-35000483 TAGCAGTCTTTGCCAGAGGATGG + Intronic
1156295660 18:35788077-35788099 GAACAGTGGTTACCAGAGAGTGG + Intergenic
1156317860 18:35987742-35987764 GAGCAGTTGTTGCCAGGGGCTGG + Intronic
1156412695 18:36849194-36849216 GAACAGTGGTTACCAGGGGCTGG - Intronic
1156632560 18:38987587-38987609 GAATAGTGGTTACCAGAGGATGG + Intergenic
1157217032 18:45792810-45792832 GACCAGCTGTTACAAGAGGAAGG + Intergenic
1157854235 18:51090378-51090400 GATCAGTAGTTGCCAAGGGAGGG + Intergenic
1158210895 18:55048619-55048641 GACCAGTAGTTCCCTGAGGCTGG + Intergenic
1158374082 18:56843388-56843410 GAACAGTGGTTGACAGAGGATGG - Intronic
1158477265 18:57791159-57791181 GAGCAGTGGTTGCCAGGGGCTGG - Intronic
1159089446 18:63831241-63831263 CAGCTGTAGTTACAAGAGAAAGG + Intergenic
1159490390 18:69125730-69125752 GAACAATGGTTACCAGAGGCTGG + Intergenic
1159667308 18:71177297-71177319 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1160412307 18:78683376-78683398 GAGCAGTAGGCACATGAGGAGGG - Intergenic
1160425014 18:78773518-78773540 GTGCAGGATTTACCTGAGGAGGG + Intergenic
1161878581 19:6931095-6931117 GAACAGCAGTTACCAGAAGCTGG - Intronic
1162221950 19:9185000-9185022 AAACAGTGGTTACCAGAGGAGGG + Intergenic
1163200501 19:15764531-15764553 GAATGGTGGTTACCAGAGGAGGG + Intergenic
1163639560 19:18453985-18454007 GATTAGTAGTTACCAGGGGCTGG + Intronic
1164662953 19:29994441-29994463 GAATAGTGGTTACCAGGGGATGG - Intronic
1165367834 19:35380261-35380283 GACCAGTAGTTACCAGGGGCTGG + Intergenic
1165593234 19:36989008-36989030 GAACAGTAGTTACCAGAGACGGG - Intronic
1168371774 19:55841300-55841322 GAACAGTGGTTACTAGAGGCTGG - Intronic
1168391973 19:56016621-56016643 GAACAGTGGTTACCAGAGGCTGG - Intronic
925032265 2:660159-660181 GATCAGTGGTTACCAGGGGTTGG + Intergenic
925650403 2:6083398-6083420 GAGCAGTGGTTACCAGGGTGAGG - Intergenic
925915724 2:8604139-8604161 GATCAGTGGTTGCCAGAGGCTGG + Intergenic
925940236 2:8810043-8810065 GAGCACAAGGTACCAGGGGACGG - Intronic
926000283 2:9325660-9325682 GAGAAGTAGTAACCAGTGCAAGG - Intronic
926085522 2:10017515-10017537 GGGCAGTGGTTACCAGGGGCTGG - Intergenic
927082284 2:19642432-19642454 GAGAAGGACTGACCAGAGGATGG - Intergenic
927580056 2:24235304-24235326 GATCAGTGGTTGCCAGGGGATGG + Intronic
927644101 2:24864684-24864706 GAACAGTGGTTACCAGAGTCTGG + Intronic
928704613 2:33934526-33934548 GAACAGAAGATACCAGAGGCTGG - Intergenic
929271023 2:39972004-39972026 GAGGAGTGGTTACCAGAAGCTGG + Intergenic
929531433 2:42755506-42755528 GAGCTTTACTTACAAGAGGAAGG - Exonic
929704112 2:44192733-44192755 GAATGGTAGTTACCAGAGGCTGG - Intronic
930114947 2:47710525-47710547 GAGCAGTGGTTCCCAAAGGAGGG + Intronic
930282426 2:49386195-49386217 GAACAGTGGTTACCAGAGGTGGG - Intergenic
930284085 2:49406127-49406149 GAAGAGTGGTTACCAGAGGCTGG - Intergenic
930912450 2:56645757-56645779 GAGTGGTAGTTAGCAGAGGCTGG + Intergenic
930922977 2:56779835-56779857 GAACAGTGGTTCTCAGAGGATGG + Intergenic
930925490 2:56813500-56813522 GACCGGTAGTTGCCAGAGTATGG + Intergenic
931126109 2:59278641-59278663 GATCAGTGGTTGCCAGAGGCTGG - Intergenic
931192276 2:60015558-60015580 GAACAGTTGTTACCAGAAGCTGG + Intergenic
931485346 2:62684991-62685013 GAACAGTGGTTACCAGAGGCTGG + Intronic
931631446 2:64304768-64304790 GAATAGTGGTTACCAGAGGCTGG - Intergenic
931736973 2:65204578-65204600 GAATAGTGGTTACCAGAGGCTGG + Intergenic
931754527 2:65360648-65360670 GAACAGTGGTTGCCAGAGGCGGG + Intronic
932705011 2:74017406-74017428 GAACAGTGGTTATCAGAGGCTGG - Intronic
932716699 2:74105660-74105682 GAACAGTAGTTTGCAGAGCAAGG + Exonic
933010773 2:77060004-77060026 GAGCAGGAGTTAGCAGACTATGG + Intronic
933657153 2:84898324-84898346 GAACAGTGGTTACCAGTGGCTGG - Intronic
933974807 2:87500554-87500576 GAGCAGTGGTTACTAGTGGCTGG + Intergenic
934521174 2:95021105-95021127 GAGCAGTGGTTACCAGGTGAAGG - Intergenic
934531666 2:95093494-95093516 GAGACGTAGATTCCAGAGGAAGG + Intronic
934612223 2:95748994-95749016 GAGGAATGGTTACCAGAGGCTGG + Intergenic
934841929 2:97630462-97630484 GAGGAATGGTTACCAGAGGCTGG - Intergenic
934977263 2:98811710-98811732 GATCAGTAGTTGCCAGGGGTTGG - Intronic
935009966 2:99125062-99125084 GAGCAGTAGTTACCAGGAATTGG - Intronic
935272563 2:101447778-101447800 GAATAGTGGTTACCAGAGGCTGG - Intronic
935533082 2:104259639-104259661 GAGGAATGGTTACCAGAGGCTGG + Intergenic
935843957 2:107144630-107144652 GAGATGAAGTTTCCAGAGGAAGG - Intergenic
936319019 2:111450260-111450282 GAGCAGTGGTTACTAGTGGCTGG - Intergenic
937261475 2:120589044-120589066 GGACAGGGGTTACCAGAGGAGGG + Intergenic
937404004 2:121610852-121610874 GAGGAGGAGTTACAGGAGGAAGG + Intronic
937481903 2:122270130-122270152 GAGCAGTGGTTTCCAGGGGATGG - Intergenic
937541461 2:122959908-122959930 GATCAGTGGTTGCCAGAGGTCGG + Intergenic
937577444 2:123441185-123441207 AAACAATGGTTACCAGAGGATGG + Intergenic
937753796 2:125511712-125511734 GAATGGTAGTTACCAGAGGTTGG + Intergenic
937875442 2:126822036-126822058 GAACAGTGGCTACCAGAGGCTGG + Intergenic
937974105 2:127570766-127570788 AATCAGTAGTTGCCAGGGGAGGG - Intronic
938203084 2:129392928-129392950 GAATAGTGGTTACCAGAGGCTGG + Intergenic
938743144 2:134251908-134251930 GAACAGTGGTTACCAGGGGTGGG - Intronic
938842525 2:135176920-135176942 GAATAGTAGTTACCAGAGGCCGG + Intronic
938848812 2:135239221-135239243 GATTAGTGGTTACCAGAGGCTGG + Intronic
938985991 2:136576929-136576951 GAGCAGTAGTAAAAAGAAGAGGG - Intergenic
939676890 2:145083548-145083570 GAATAGTAGTTATCAGAGGCAGG - Intergenic
939763626 2:146217144-146217166 GAGTGGTGGTTACCAGAGGCTGG + Intergenic
939962066 2:148573978-148574000 GAGCAGTGGTTGCCAAAGGTTGG + Intergenic
940072570 2:149705343-149705365 CAGTAGTGGTTACCAGAGGCTGG - Intergenic
940110897 2:150152545-150152567 GATCAGTGGTTACCAGGGGTTGG - Intergenic
940325256 2:152418470-152418492 GAACAGTGGTTACCAGGGGAAGG - Intronic
940509614 2:154596637-154596659 AATCAGTAGTTGCCAGAGGCTGG + Intergenic
940832826 2:158487099-158487121 GAGAAGTAGTGGCCAGAGAATGG + Intronic
940839033 2:158558342-158558364 AAGCAGTATTTACAAGAGGTGGG + Intronic
940988421 2:160073027-160073049 GAACAGTGGTTACCAGGGGGAGG + Intergenic
941237952 2:162998518-162998540 GATTAGTAGTTGCCAGAGCATGG - Intergenic
941707892 2:168679153-168679175 CAGCAGTAGTTACCAGAGATTGG + Intronic
941737745 2:168998270-168998292 GAATAGTAGTTAACAGAGGCTGG + Intronic
942324049 2:174760526-174760548 GAGCAGGAGTTACCAGGGACTGG + Intronic
942350259 2:175045214-175045236 GAACAGTGGTTACCAGAGATGGG - Intergenic
942989399 2:182181450-182181472 GAGCTGAAGCTTCCAGAGGAAGG - Intronic
944159898 2:196647926-196647948 GAACAGTAGTTAACAAAGGCTGG - Intronic
944485812 2:200204020-200204042 GAGGTGTTGTTACCAGTGGAAGG - Intergenic
944486199 2:200208359-200208381 GAACAGCAGTTACCAGAGCCTGG + Intergenic
944762735 2:202833893-202833915 GAATGGTAGTTACCAGAGGCTGG + Intronic
945128148 2:206536403-206536425 GAACAGTGGTTACCAGGGGCAGG + Intronic
945711578 2:213303540-213303562 GAGCAATAATTACCAGAGGCTGG - Intronic
946044699 2:216811246-216811268 GAATAGTGGTTACCAGAGGCTGG + Intergenic
946092790 2:217245833-217245855 GAGCAATATGTAACAGAGGACGG - Intergenic
946403418 2:219480688-219480710 GAGGGGTCCTTACCAGAGGAAGG - Exonic
947225765 2:227839046-227839068 GGGAAGAAGTTTCCAGAGGAAGG - Intergenic
947352320 2:229258950-229258972 GATCAGTAGTTACCTGAGGATGG - Intronic
948583888 2:239006406-239006428 GAACAGTGGTTCCCAGAGGATGG - Intergenic
948659020 2:239495368-239495390 GAGCAGAAGTTCACAGAGGCTGG + Intergenic
948766789 2:240226526-240226548 TAGCAGTAGTTAGCAGTGGCTGG + Intergenic
1168882341 20:1217527-1217549 GAGCTGAAGCTTCCAGAGGAAGG + Intergenic
1169528769 20:6460719-6460741 GAACAGTGGTTACCAGAGACTGG + Intergenic
1169536864 20:6553837-6553859 GATCAGTAGTTGCTAGAGGGTGG - Intergenic
1169745511 20:8938626-8938648 GTGGAGTACTTACTAGAGGAAGG + Intronic
1169997841 20:11578356-11578378 GACCAGTAGTTTCCAGAGGCAGG + Intergenic
1170064511 20:12296096-12296118 GAATAGTAGATACCAGAGGCTGG - Intergenic
1170380212 20:15750970-15750992 GAACAGTGGTTACCAGAGATGGG + Intronic
1170410667 20:16087647-16087669 GAGCAGATGATACCAGAGGCTGG + Intergenic
1170511176 20:17078341-17078363 GAACAATGGTTACCAGAGGCTGG - Intergenic
1170651750 20:18249117-18249139 GATCAGTAGTTGCCAGGGGTTGG - Intergenic
1170816159 20:19716186-19716208 GAGCAGTGGTTCTCAGAGGGTGG - Intronic
1171943961 20:31359261-31359283 GAATAGTGGTTAACAGAGGATGG + Intergenic
1172369705 20:34379500-34379522 GAATAGTAGTTACCAGAGCAGGG - Intronic
1173665282 20:44758573-44758595 GAGATCTTGTTACCAGAGGAAGG - Intronic
1174394057 20:50235068-50235090 GATCGGTAGTTGCCAGAGGCTGG - Intergenic
1175048332 20:56128277-56128299 GAGCACAAGGTACCAGAGCAGGG + Intergenic
1175557792 20:59883678-59883700 AAACAGTGGTCACCAGAGGATGG + Intronic
1176136554 20:63524984-63525006 GAGCAGGAGTGAGCGGAGGATGG + Intergenic
1177224248 21:18233137-18233159 GAACAGTGGTTATCAGAGGCTGG - Intronic
1178573637 21:33764499-33764521 GATCAGCAGTTGCCAGGGGATGG + Intronic
1178953816 21:37006377-37006399 GAGAAGGGGTGACCAGAGGATGG - Intronic
1179837855 21:44049387-44049409 GAGCAGCAGTGACAGGAGGATGG - Intronic
1180601802 22:17024744-17024766 GAGCAGTGGTTCCCACAGAATGG + Intergenic
1180657133 22:17431952-17431974 GCTCAGTGGTTTCCAGAGGATGG - Intronic
1180862801 22:19096323-19096345 GAGTAGTGGTTACCAGAGGCTGG + Intronic
1180929837 22:19581925-19581947 GAATAGTGGTTACCAGAGGGTGG + Intergenic
1181235026 22:21443503-21443525 GGGCAGTAGATCCCAGAGGGCGG + Intronic
1182445353 22:30386719-30386741 GAGCAGGAGGCACCAGTGGAAGG - Exonic
1183218646 22:36497565-36497587 AAGCAGCAGATCCCAGAGGATGG - Intronic
1185021629 22:48380011-48380033 GAGCAGGAGGTACCAGAAGGAGG + Intergenic
951229936 3:20166552-20166574 AAGTAGTGGTTACCAGAGGTTGG + Intronic
951314589 3:21173348-21173370 GAATAGTAGTTACCAGATGTTGG - Intergenic
951631258 3:24723460-24723482 GAATAGTAGTTACCATAGGCTGG - Intergenic
952102591 3:30032073-30032095 GAACGGTGGTTACCAGAGGCTGG - Intergenic
952178521 3:30893540-30893562 GAATAGTGGTTACCAGAGGCTGG - Intronic
953156469 3:40379619-40379641 GAATAGTGGTTACCAGAGGCTGG + Intergenic
953836801 3:46353290-46353312 GAGCAGTGGTTACCAGAGACTGG + Intergenic
953894922 3:46789897-46789919 GATCAGTAGTTTCCAGGGGTTGG + Intronic
954086702 3:48250270-48250292 AAATAGTAGTTACCAGAGGTTGG - Intronic
954412399 3:50376527-50376549 GGGCAGTAGTGGCTAGAGGAGGG - Intronic
954470534 3:50690579-50690601 GAACAGTAGTTGCCAGGGGTTGG - Intronic
954910194 3:54099079-54099101 GAATAGTGGTTAGCAGAGGATGG - Intergenic
954950389 3:54467699-54467721 GAATAGTGGTTACCAGAGGATGG + Intronic
955462188 3:59195374-59195396 GACTAGCAGTTACCAGAGGCTGG + Intergenic
955479320 3:59373597-59373619 GACCAGTAGTTTCCAGGGGTTGG + Intergenic
956472903 3:69587392-69587414 GAATAGTGGTTACCAGAGGCAGG + Intergenic
957375797 3:79355579-79355601 GAACAGTGGTTACCAGAGGACGG - Intronic
958645336 3:96864516-96864538 GATTAGTGGTTACCAGAGGATGG + Intronic
958651626 3:96943011-96943033 GAATAGTAGTTACCAGAGGCTGG - Intronic
958924247 3:100140360-100140382 GATCAGTAGTGACCAGAGACTGG - Intronic
959354902 3:105313496-105313518 GAACAGTGGCTACCAGAGGCAGG + Intergenic
959594957 3:108119828-108119850 GACTAGTGGTTACCAGAGGCTGG + Intergenic
959685851 3:109145449-109145471 GAATAGTAGTTACCAGGGGTTGG + Intergenic
959763438 3:109996154-109996176 GAAGAATAGTTACCAGAGGCTGG - Intergenic
959826381 3:110801950-110801972 AAACAGTAGTTACCAAAGGTAGG + Intergenic
960121988 3:113956509-113956531 GAGCAGTGGGTACCACAGTATGG + Intronic
960717340 3:120589785-120589807 GATCAGTGGTTGCCAGAGGTTGG + Intergenic
960794920 3:121475223-121475245 GAACAGCTGTTACCAGAGGCTGG - Intronic
960872163 3:122260925-122260947 GAGGAGGAATAACCAGAGGAGGG + Intronic
960905265 3:122594930-122594952 GTTCAGTATTTCCCAGAGGAGGG + Intronic
961040460 3:123674669-123674691 GAGCAGTACTTCCCAAAGGAAGG - Intronic
961842914 3:129732707-129732729 GAGCTGTGGTTACAAGAGGGTGG - Intronic
961911605 3:130322946-130322968 GTACAGTAGTTAACAGTGGATGG + Intergenic
962044879 3:131746440-131746462 GAATTGTAGCTACCAGAGGATGG - Intronic
962365872 3:134780420-134780442 GATTAGTGGTTACCAGGGGATGG - Intronic
962689773 3:137882778-137882800 GAATAGTGGTCACCAGAGGATGG + Intergenic
962834082 3:139171822-139171844 GAGACGAAGTTTCCAGAGGAAGG - Intronic
963210711 3:142686588-142686610 GAACAGTAGTTACCAGGGCCTGG - Intronic
963361856 3:144283989-144284011 GATCAGTAGTTGCCAGAGCCAGG + Intergenic
963528162 3:146440123-146440145 GAGAAGAAGCTTCCAGAGGAAGG - Intronic
963757513 3:149250994-149251016 GAGTGGTAGGTAGCAGAGGAGGG + Intergenic
963984399 3:151575226-151575248 AAGCAGTAGTTATCCCAGGATGG - Intergenic
964035305 3:152188486-152188508 AAACAATAGTTACCAGAGGCTGG - Intergenic
964357173 3:155861456-155861478 GATCGGTGGTTACCAGAGGTTGG - Intergenic
964651817 3:159019917-159019939 GAGTAATGGTTACCAGAGGCTGG - Intronic
964929353 3:161997645-161997667 GAGTGGTAGTTTTCAGAGGATGG - Intergenic
965285077 3:166808912-166808934 GAATAATAGTTACCAGAGGATGG + Intergenic
965344858 3:167536053-167536075 GAACAGTGGATACCAGAGGATGG + Intronic
965357567 3:167695057-167695079 GAGCAGTAGTTCTCAGACCAGGG - Intronic
965505383 3:169509526-169509548 GAACAGTGGTTACCAGGGGCAGG - Intronic
966100381 3:176262007-176262029 GAATGGTAGTTACCAGAGGCTGG - Intergenic
966399385 3:179532876-179532898 GATCAGTGGTTACCAGGGGAAGG - Intergenic
966399393 3:179532952-179532974 GATCAGTGGTTCCCAGGGGAAGG - Intergenic
967006110 3:185384112-185384134 GAACAATAGTTACCAGAAGCTGG - Intronic
967883323 3:194316686-194316708 GAAGAGTGGTTACCAGAGGCTGG - Intergenic
967967957 3:194977008-194977030 GACCAGTAGTTTCCAGGGGAGGG - Intergenic
968576024 4:1366530-1366552 AAGCAGCAGTTACCACAAGATGG - Intronic
969728056 4:8937237-8937259 GAACGGTGGTTACCAGAGAATGG + Intergenic
969783966 4:9437407-9437429 GAACAGTGGTTACCAGAGGCTGG + Intergenic
970212485 4:13724484-13724506 GAGTAGAAGTTACCAGAGGCTGG - Intergenic
970679489 4:18490115-18490137 GAGACGAAGTTTCCAGAGGAAGG + Intergenic
970784575 4:19780573-19780595 GAGTACTTGTCACCAGAGGATGG + Intergenic
970847073 4:20553287-20553309 GAGAAGTATTTACAAGATGATGG - Intronic
970996664 4:22275524-22275546 AAAAAGTAGTTACCAGATGATGG + Intergenic
971005707 4:22372263-22372285 GAATAGTAATTACTAGAGGATGG + Intronic
971903076 4:32688008-32688030 GAGTAGTAGTTACAAGGGGTTGG + Intergenic
972170741 4:36342554-36342576 GAACAGGAGTCAACAGAGGACGG + Intronic
972436054 4:39036547-39036569 GATCAGTGGTTGCCAGAGGCTGG + Intergenic
972614378 4:40684021-40684043 GAACAGTGGTTACCAGCGGCTGG - Intergenic
972884281 4:43466163-43466185 GAATAATAGTTACCAGAGGCTGG - Intergenic
972979948 4:44685171-44685193 GAGCAGTAGTTGTCAGTGGTGGG + Intronic
972996655 4:44887431-44887453 GAGTAATGGTTACCAGAGGCTGG - Intergenic
973159477 4:46997512-46997534 GAATGGTAGTTACCAAAGGAGGG - Intronic
973724513 4:53761911-53761933 GAATGGTAGTTACCAGAGGCTGG + Intronic
973732310 4:53834111-53834133 GGGAAGAAGTTTCCAGAGGAAGG + Intronic
973966216 4:56164629-56164651 GATCAGTGGGTACCAGAGGTTGG + Intergenic
974036568 4:56822821-56822843 GAACAGTAGTTACTAGAGGCTGG - Intergenic
974068658 4:57104018-57104040 GAACAGCAGTTACCAGAGATGGG - Intronic
974107031 4:57481353-57481375 GAACAGCAGTTACCAGAAGATGG + Intergenic
974661943 4:64901286-64901308 GAATAATAGTTACCAGAGGCTGG + Intergenic
974771133 4:66415138-66415160 GATCAGTGGTTTCCAGAGGCAGG + Intergenic
975200267 4:71579454-71579476 AAACAGTAGTTACCAGGGGCTGG + Intergenic
975227138 4:71886725-71886747 GAATGGTGGTTACCAGAGGATGG - Intergenic
975388393 4:73786277-73786299 GAATAGTGGTTACCAGAGGCAGG + Intergenic
975789496 4:77933268-77933290 GAGCTGTAGTCACAAGAGGGTGG + Intronic
975915233 4:79317264-79317286 AAGGAGGAGTTACCAGAGAAAGG + Exonic
976062079 4:81140129-81140151 GAGGAGTGGTTACCAGAGCCTGG + Intronic
976183067 4:82417442-82417464 GAACAGCAGTTACCAGAGACTGG - Intergenic
976206692 4:82629174-82629196 CACCAATAGTTACCAGAGGTGGG - Intergenic
976999266 4:91475810-91475832 GAATAGTGGTTACCAGAGGCTGG - Intronic
977429706 4:96915920-96915942 GAATAGTGGTTACCAGAGGCTGG + Intergenic
977477539 4:97531689-97531711 GAGGTATAGTTACCAGAGGCTGG + Intronic
978020986 4:103811471-103811493 GAAAATTATTTACCAGAGGATGG + Intergenic
978076350 4:104535153-104535175 GAATAGTAGTTACCAGAGGCTGG - Intergenic
978129527 4:105178412-105178434 GAGCAGTGTTTTCCAGAGGGAGG + Intronic
978400178 4:108322850-108322872 GAGGAATGGTTACCAGAGGCTGG + Intergenic
978798893 4:112735852-112735874 GAACAGTAGTTACCATGGGCTGG - Intergenic
979448900 4:120845539-120845561 GAGCAGTAGTTTTCAGAAGTGGG - Intronic
979571280 4:122228402-122228424 GATCAGTAGTTGCCTGAGGTAGG - Intronic
979800907 4:124907734-124907756 GAACAGTGGTTACCAGGGGCAGG - Intergenic
980096618 4:128497888-128497910 GAATAGTAGTTACTAGAGGCTGG - Intergenic
980559512 4:134454542-134454564 GAGCCATATTTTCCAGAGGAAGG - Intergenic
980659163 4:135833819-135833841 GAGTGATAATTACCAGAGGATGG - Intergenic
980679886 4:136146450-136146472 GAATAGTAGTTACCAGAGTCTGG - Intergenic
980713420 4:136600466-136600488 GAACAATAGTTACCACAGGGTGG + Intergenic
980967990 4:139542214-139542236 GAACAGTGGTTAACAGAGGCTGG + Intronic
981520749 4:145659976-145659998 GAACAGTGGTTACCAGAGACTGG - Exonic
981733646 4:147926109-147926131 GAGCAGTTGTATCCAGAGGGTGG + Intronic
981985706 4:150852615-150852637 AATCAGGAGTTACCAGATGAAGG - Exonic
982176808 4:152713430-152713452 GAACAGTGATTACCAGAGGCTGG + Intronic
982540895 4:156669266-156669288 GAATGGTAGTTACCAGAGGCTGG - Intergenic
982688151 4:158517255-158517277 GAATAGTGGTTACCAGAGGCTGG + Intronic
982705304 4:158702487-158702509 GAACAGTGGCTACTAGAGGATGG - Intronic
983162109 4:164429338-164429360 GAATGGTAGTTACCAGAGGCTGG - Intergenic
983457186 4:167979991-167980013 GAAGAATAGTTACCAGAGGCAGG + Intergenic
983774533 4:171590795-171590817 GAATGGTAGTTACCAGAGGCTGG - Intergenic
984035744 4:174665281-174665303 GAACAGTAGTTACCCAAAGAAGG - Intronic
984209544 4:176829031-176829053 GAAGAATAGTTACCAGAGGCTGG + Intergenic
984291513 4:177801005-177801027 GAGCAGTAGTTACCAGAGGATGG - Intronic
984343999 4:178497081-178497103 GAATAGTAGCTACCAGAGGCTGG + Intergenic
984522174 4:180814938-180814960 GAACAATGGTTACCAGAGGCTGG - Intergenic
984783590 4:183548117-183548139 GAACAGTGGTTACCAGGGGCTGG - Intergenic
984978312 4:185251410-185251432 GAACAGTGGTTACCAGAGGCTGG - Intronic
985287560 4:188351872-188351894 GAACGGTGGTTACCAGAGGCTGG - Intergenic
985335677 4:188891067-188891089 GAACTATAGTTACCAGAGGCTGG - Intergenic
985480011 5:103877-103899 GACTAGTGGTTACCAGAGGCTGG - Intergenic
985845862 5:2346518-2346540 GAGATGGAGTTCCCAGAGGAAGG - Intergenic
985860025 5:2463647-2463669 GAACAGTAGGGACCAGAGGCTGG + Intergenic
986009800 5:3701898-3701920 GAATAGTGGTTACCAGAGGCCGG - Intergenic
986697368 5:10369663-10369685 GATCAGTAGTTGCCAGGGGCTGG - Intronic
986853988 5:11847455-11847477 GAATAGTGGTTACCAGAGGCTGG + Intronic
986891040 5:12306019-12306041 GACCAGTGGTTACCAGAGGCTGG + Intergenic
986951641 5:13093785-13093807 GAGTAGTGGTTTCCAGAGGCTGG + Intergenic
987114451 5:14714880-14714902 CTACAGTAGTGACCAGAGGAGGG - Intronic
988145042 5:27294258-27294280 AAACAGTAGTTTCCAGGGGATGG - Intergenic
988248202 5:28717512-28717534 GAATAGTAGTTACCAGAGCATGG + Intergenic
988271713 5:29025806-29025828 GAATAGTGGTTACTAGAGGATGG + Intergenic
988546072 5:32158615-32158637 GAGCAGGAGCTGCCAGAAGAGGG - Intronic
988843427 5:35105012-35105034 GAGACGAAGTTTCCAGAGGAAGG + Intronic
990070087 5:51771503-51771525 GAACAGTGGTTACCAGTGGTTGG - Intergenic
990098167 5:52145707-52145729 GATCAGTAGTTGCCAGAGGTTGG + Intergenic
992012491 5:72542721-72542743 GATTGGTAGTTACCAGAGGCTGG - Intergenic
992310726 5:75496759-75496781 CAACAGTGGTTACCAGAGGTTGG + Intronic
992342724 5:75842396-75842418 GAGCAGTAGTTACGAGGGGCTGG - Intergenic
993345846 5:86781231-86781253 GAATGGTAGTTACCAGAGGTTGG + Intergenic
993553691 5:89308182-89308204 AAACAGTGGTTACCAGAGGCTGG + Intergenic
993699059 5:91096889-91096911 GAACAGAAGTTACCAGGGGCTGG - Intronic
993814195 5:92520671-92520693 GAGTGGTGGTTACCAGAGGCTGG - Intergenic
993896327 5:93539572-93539594 GAACAGTGGTTACCAGAGACTGG + Intergenic
994032577 5:95161415-95161437 GAATGGTAGTTACCAGAGGCTGG + Intronic
994059131 5:95454727-95454749 GAACAGTAGTTGCCAGGGGCTGG + Intergenic
994071607 5:95609206-95609228 GAGCAGTGGTTACTAGAGGTGGG - Intergenic
994200116 5:96964059-96964081 GAACAGTAGTTACCAAAGACTGG - Intronic
994479518 5:100316336-100316358 AAGCAGTAGTTACTAAAGGCTGG + Intergenic
995701624 5:114941868-114941890 GAATAGTGGTTACCAGAGAATGG + Intergenic
995735171 5:115293151-115293173 GAACAATAGTTGCCAGAGGCTGG + Intronic
995768853 5:115648145-115648167 GAACAGTAGTTCTCAGAGTATGG - Intergenic
996041449 5:118817739-118817761 GACCAGTGGTTATCAGAGGCTGG + Intergenic
996373803 5:122781186-122781208 GATCAGTGGTTGCCAGAGGCTGG - Intronic
996410587 5:123154779-123154801 GAGAAGTAGCTACCAGCAGAAGG + Intronic
996438565 5:123463219-123463241 GAACAGTAGTTGCCAGGGGCTGG - Intergenic
996835806 5:127790623-127790645 GAATGGTAGTTACCAGAGGCTGG - Intergenic
997205646 5:132047596-132047618 GAGTAGTTGTTACCAGGGGCTGG - Intergenic
997888518 5:137654066-137654088 GATCAGTAGTTGTCAGAGGCTGG + Intronic
998173404 5:139885656-139885678 AAGCTGAAGTTACCAGAGAAAGG + Intronic
998187071 5:139988611-139988633 GATCAGTAGTTGCCAGAGGTTGG + Intronic
998196024 5:140072216-140072238 GATCAGTAGTTGCCAGAGTATGG - Intergenic
998206273 5:140158770-140158792 CAACAGTAGGTACCTGAGGAAGG - Intergenic
998738140 5:145166907-145166929 GAACAGTGGTTACCAGAGGCTGG + Intergenic
999006906 5:147991386-147991408 GATCAGTGGTTGCCAGAAGATGG - Intergenic
999593384 5:153173677-153173699 GAATAGTAGTCACCAGAGGATGG - Intergenic
1000001865 5:157146299-157146321 GATCAGTGGTTACTAGAGGATGG - Intronic
1000142158 5:158416115-158416137 GAACAGTGGTTACCAGAGGCGGG + Intergenic
1000531925 5:162433359-162433381 GAACAATGGTTACCAGAGGCTGG - Intergenic
1000969183 5:167695112-167695134 GAGCAGAATTTTCCAGAGTATGG + Intronic
1001581791 5:172803737-172803759 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1001714181 5:173801578-173801600 GAGTAGAAGTTACCAGGGGCCGG + Intergenic
1001850597 5:174961361-174961383 GAAGAGTAGTTACCAGAGGCTGG - Intergenic
1002899873 6:1401600-1401622 GAAAAGTGGTTACCAGAGGCTGG + Intergenic
1003173106 6:3735583-3735605 GAACAGTGGTTACCAGAGGCTGG + Intronic
1003182254 6:3802102-3802124 GAGCAGTAGTTGCCAGGGCCTGG + Intergenic
1003215118 6:4102276-4102298 GAGTAGTGGTTGCCAGAGGTTGG + Intronic
1003718759 6:8676818-8676840 GAGCAGTGGTTACCAGCAGCTGG - Intergenic
1003884758 6:10511705-10511727 GAACAGTGGTTACCAGAGAATGG + Intronic
1004102157 6:12624671-12624693 GAACAGTGGTTACCAAAGGCTGG + Intergenic
1004313050 6:14562858-14562880 GAATTGTAGTTACCAGAGGCTGG + Intergenic
1004912092 6:20296047-20296069 GATTAGTGGTTACCAGAGGCTGG - Intergenic
1005593634 6:27354840-27354862 GAGTAATAGTCACCAGAGGTTGG + Intergenic
1005657744 6:27960003-27960025 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1005938178 6:30540348-30540370 GAATAGTAGTTACCAGAGGCTGG + Intergenic
1006505147 6:34484421-34484443 GATCAGTAGTTATCAGAGATTGG + Intronic
1006992550 6:38227934-38227956 GATCAGTGGTTGCCAGAGGTTGG + Intronic
1007466373 6:42054497-42054519 GATTAGAAGTTACCAGGGGATGG - Intronic
1008017481 6:46537597-46537619 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1008445554 6:51585964-51585986 GATCAATAGTTGCCAGAGGTTGG - Intergenic
1009057237 6:58351255-58351277 GAGCAGCGATAACCAGAGGATGG + Intergenic
1009233991 6:61100311-61100333 GAGCAGCAATACCCAGAGGATGG - Intergenic
1009334334 6:62467339-62467361 GCTAAGTAGTTACCAGAGGCTGG - Intergenic
1010057110 6:71579321-71579343 GAGCAGTTCTTACCAGAAGCTGG - Intergenic
1010159809 6:72840016-72840038 GATTGGTAGTTACCAGAGGTTGG - Intronic
1010246592 6:73665332-73665354 GAATAGTAGTTACCAGAGGTTGG + Intergenic
1010443367 6:75924944-75924966 GAACAGTAGTTACCAGAGACTGG + Intronic
1010488283 6:76442846-76442868 GAGTGGTGGTTACCAGAGGCTGG - Intergenic
1010489554 6:76459022-76459044 GAATGGTAGTTACCAGAGGCTGG - Intergenic
1010516838 6:76783698-76783720 GAATGGTAGTTACCAGAGGCTGG + Intergenic
1010621509 6:78082452-78082474 GATTAGTGGTTACCAGAGGCAGG + Intergenic
1010626769 6:78146285-78146307 GAACAATGGTTACCAGAGGCTGG + Intergenic
1010682997 6:78818300-78818322 GAGATGAAGTTTCCAGAGGAAGG + Intergenic
1010888469 6:81273367-81273389 GAATAGTAGTTACCAGGGGCTGG + Intergenic
1011379572 6:86728210-86728232 GAACAGTGGTTACCAGAGGCTGG + Intergenic
1011446652 6:87448665-87448687 GAATAGTGGTTACCAGAGGCTGG - Intronic
1011901915 6:92309007-92309029 GAAGAGTGGTTACCAGAGGCTGG + Intergenic
1012048152 6:94304954-94304976 TATCAGTGCTTACCAGAGGATGG + Intergenic
1012199318 6:96385970-96385992 GAGAAGTAGGCACCAGAGTAGGG - Intergenic
1012418234 6:99033411-99033433 GATGAGTAGTTGCCAGAGGTTGG + Intergenic
1012602863 6:101119495-101119517 GAGAAGTAGTCAAAAGAGGAGGG - Intergenic
1012619285 6:101320593-101320615 GAACAGAAGTTAACAGAGGATGG - Intergenic
1012990839 6:105924111-105924133 GAGTGATAGTTACCAGAGGCTGG - Intergenic
1013388728 6:109660881-109660903 GAGCAGTAGTTATCAGAGAGTGG - Intronic
1013502567 6:110767195-110767217 GAACAGTGGTTACCAGAGGTTGG + Intronic
1014693025 6:124585287-124585309 GAACAATGGTTACCAGAGGCTGG + Intronic
1015351336 6:132223885-132223907 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1016385455 6:143526509-143526531 GAGCAGAAGATACTAGAGGCTGG + Intergenic
1016598505 6:145828601-145828623 GAACAGTGTTTACCAGAGAACGG + Intergenic
1017550513 6:155501760-155501782 GATCAGTAGTTGCCAGAGGCTGG - Intergenic
1017568861 6:155720156-155720178 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1017661228 6:156675934-156675956 GAACAGTGGTTATCAGAGGATGG + Intergenic
1017832262 6:158141260-158141282 GATCAGTGGTTACCAGGGGCTGG + Intronic
1018217273 6:161540940-161540962 GAGCAGCATTTTCCAGAGTACGG - Intronic
1018600723 6:165537257-165537279 GATTGGTAGTTACCAGAGGCCGG + Intronic
1020000754 7:4754241-4754263 GAGCAGAAGTCACCACTGGAAGG + Intronic
1020761593 7:12273735-12273757 GAATAATAGTTACCAGAGGCAGG - Intergenic
1021552411 7:21885433-21885455 GAACAGTGGTTACCAGAGACTGG + Intronic
1021652743 7:22847540-22847562 GATCAGTAGTTGCCAGGGGTTGG - Intergenic
1023026148 7:36051839-36051861 GAGCAGTAGTTCCCAGCAGTGGG - Intergenic
1023189657 7:37566261-37566283 GAACAATGGTTACCAGAGGCTGG - Intergenic
1023704043 7:42920975-42920997 GCACAGTGGTTACCAGAGGCTGG + Intronic
1023739296 7:43264252-43264274 GAATGGTAGTTACCAGAGGCTGG - Intronic
1024032574 7:45476075-45476097 GATCAGTGGTTGCCAGAGGTTGG + Intergenic
1024220095 7:47280543-47280565 GAACAGTTGTTACCAGTAGACGG + Intronic
1024558929 7:50627662-50627684 GAGAAGTAGAGTCCAGAGGACGG + Intronic
1025029161 7:55542427-55542449 GAAGAGTGGTTACCAGAGGCTGG - Intronic
1025112054 7:56225657-56225679 GAACAGTGGTTACCAGGGGCAGG - Intergenic
1026209025 7:68286777-68286799 GAACAGTGGTTACCAGAGACTGG + Intergenic
1026305822 7:69140764-69140786 GAACAGTGGTTACCAGGGGTGGG + Intergenic
1026665848 7:72338980-72339002 TACCAGTGGTTACCAGAGGTTGG - Intronic
1026670663 7:72387859-72387881 GAACAGTGGTTACCAGAGGTTGG + Intronic
1026932211 7:74229619-74229641 GAGAAGTAGTGACCAGAACAGGG + Exonic
1027424359 7:78047553-78047575 GAGCTGCAGTTACCAGATTAAGG - Intronic
1027610754 7:80357645-80357667 GATTAGTAGTTGCCAGGGGATGG + Intergenic
1027675259 7:81149602-81149624 GAACAATGGTTACCAGAGGCTGG + Intergenic
1028022752 7:85797339-85797361 GAGTGGTGGTTACCAGAGGCTGG + Intergenic
1028064044 7:86359708-86359730 GATCAGTGATTACCAGAGGTTGG + Intergenic
1028180847 7:87722365-87722387 GAATAGTGGTTACCAGAGGCTGG - Intronic
1028285185 7:88987922-88987944 GAACAATGGTTACCAGAGGCTGG - Intronic
1028412293 7:90543090-90543112 GAGTGGTAGCTACCAGAGGCTGG + Intronic
1028478798 7:91281661-91281683 GATCAGTAGTTGCCAGAGGGTGG - Intergenic
1028627287 7:92891407-92891429 GAATGGTAGTTACCAGAGGCTGG + Intergenic
1028668516 7:93373719-93373741 GAAAAGTAATTACCAGAGGCTGG + Intergenic
1028862159 7:95664883-95664905 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1028949081 7:96613713-96613735 GAACAGTGGTTACCAGAGGCTGG - Intronic
1029851817 7:103469400-103469422 GAGCAATGGTTACCAGAGGCTGG - Intergenic
1029900903 7:104037963-104037985 AAACAGTAGTTACCAGGGGCAGG + Intergenic
1029951604 7:104592455-104592477 GAGAAGAAGCTTCCAGAGGAAGG - Intronic
1030063979 7:105645067-105645089 GAGCAGTGGTTGCCAGGGGATGG + Intronic
1030149653 7:106390919-106390941 GAGTAATAGGTACCAGAGGCTGG + Intergenic
1030289654 7:107859368-107859390 GATCAGTAGTTACCAGAAACTGG + Intergenic
1030389831 7:108913607-108913629 GAACAATAGTTACCAGAGGCTGG - Intergenic
1030471665 7:109971688-109971710 GAACAGTAGTTACCAGAGACTGG + Intergenic
1030579392 7:111334233-111334255 GATTTGTAGTTACCAGAGGCTGG - Intronic
1030707302 7:112707192-112707214 GAATAGTGGTTACCAGGGGATGG + Intergenic
1031054428 7:116977981-116978003 GAGAAGTAGAAGCCAGAGGAGGG - Intronic
1031190657 7:118545452-118545474 GAATGGTAGTTACCAGAGGCTGG + Intergenic
1031259432 7:119499262-119499284 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1031550024 7:123098600-123098622 GAACAGTGGTTACCAGAAGCTGG + Intergenic
1031637059 7:124114478-124114500 GAATGGTGGTTACCAGAGGATGG + Intergenic
1031730482 7:125293907-125293929 GAATAGTGGTTACCAGAGGGTGG - Intergenic
1032531908 7:132628295-132628317 GAGCAGGAGTCAACAGAGCATGG - Intronic
1032805083 7:135346111-135346133 GAGTGGTGGTTACCAGAGGCTGG - Intergenic
1032855655 7:135831659-135831681 GAACAGTGGTTACTGGAGGAAGG - Intergenic
1033175979 7:139124111-139124133 GATTAGTAGTTGCCAGAGGCTGG + Intergenic
1033446713 7:141429511-141429533 GAACAGTGGTTACCAGAGGCTGG + Intronic
1033538392 7:142333055-142333077 GAGCAGTAATTAGCAAAGGCTGG - Intergenic
1033538496 7:142334098-142334120 GAGCAGTAATTACCAGAGGCTGG + Intergenic
1033540833 7:142354372-142354394 GAGCAGCAATTACCAGAGGTTGG - Intergenic
1033642478 7:143275210-143275232 GAACAGTGATTACCAGAGGCTGG + Intergenic
1034127087 7:148683232-148683254 GAACAATGGTTACCAGAGGTTGG + Intergenic
1034757380 7:153635462-153635484 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1034869023 7:154666664-154666686 TAGTAGTGGTTACCAGAGGCTGG - Intronic
1035349398 7:158235568-158235590 GATTGGTGGTTACCAGAGGATGG + Intronic
1036835075 8:12056724-12056746 GAACAGTGGTTACCAGAGGCTGG - Intergenic
1036856919 8:12303288-12303310 GAACAGTGGTTACCAGAGGCTGG - Intergenic
1037148101 8:15598612-15598634 GATCAGTGGTTGCCAGAGGGTGG - Intronic
1037249871 8:16879061-16879083 GAGACGAAGCTACCAGAGGAAGG + Intergenic
1037444399 8:18950545-18950567 GAATAGTGGTTACCAGAGGCTGG - Intronic
1037487948 8:19366470-19366492 GAACAGTGGTTAGCAGAGGCTGG - Intronic
1037510411 8:19576616-19576638 GATCATTAGTGCCCAGAGGAGGG - Intronic
1038346328 8:26735639-26735661 TAGCAGAAGTTCTCAGAGGAAGG + Intergenic
1039217611 8:35290449-35290471 GAACAGTGGTTACCAGAGGCTGG + Intronic
1039440098 8:37589013-37589035 GGGCAGGAGTTACAACAGGAGGG + Intergenic
1039639920 8:39207723-39207745 GAATAGTGGTTACCAGAGGCTGG - Intronic
1039698704 8:39940749-39940771 GAACAGTGGTTACCAGAGGGTGG - Intronic
1040638475 8:49303641-49303663 GAATAGTGGTTACCAGAGGATGG - Intergenic
1040642907 8:49361062-49361084 GATTGGTGGTTACCAGAGGATGG - Intergenic
1040654354 8:49488377-49488399 GAAAAGTAGTTACAAAAGGAAGG + Intergenic
1040663418 8:49601585-49601607 GAGCAGTAGTTTCCAGGGCTAGG + Intergenic
1040684907 8:49860278-49860300 GAGAAGGAGTTACCAGAAGATGG + Intergenic
1040922631 8:52640222-52640244 GAATAGTGGTTACCAGAGGCTGG + Intronic
1041494877 8:58474779-58474801 GAACAGTGGTTACCAGGGGCTGG - Intergenic
1041698460 8:60762185-60762207 GAGCAGTAGTTAGAGGAAGATGG - Intronic
1041753217 8:61284190-61284212 GAATAGTGGTTACCACAGGATGG + Intronic
1041847369 8:62346043-62346065 GAATAGTTGTTACCAGAGGCAGG + Intronic
1041976852 8:63809275-63809297 GACCAGTGGTTACCTGAAGAGGG + Intergenic
1042017325 8:64328512-64328534 GAATCGTGGTTACCAGAGGATGG - Intergenic
1042074859 8:64981254-64981276 CAACAGTGGTTACCAGAGGCTGG + Intergenic
1042446115 8:68887069-68887091 CATCAGCAGTTACCTGAGGACGG + Intergenic
1042626371 8:70762298-70762320 GAACAGAAGTTACCAGGGGCTGG - Intronic
1042811025 8:72825069-72825091 GAGCAGTGGTTGCCAGGGGCTGG - Intronic
1043117451 8:76276149-76276171 GAATAGTTGTTACCAGAGGCTGG + Intergenic
1043348177 8:79324655-79324677 GAGCAGTAGTAAGCATATGATGG - Intergenic
1043910854 8:85862113-85862135 GAACAGCAGTTACCAGAGATTGG - Intergenic
1044105939 8:88206911-88206933 CAACTGTAGTTACCAGAGGCTGG - Intronic
1044149436 8:88756149-88756171 GAATAGTGGTTACTAGAGGATGG - Intergenic
1044369585 8:91393120-91393142 GCGTTTTAGTTACCAGAGGATGG - Intronic
1044601785 8:94012381-94012403 GAACAGGAATTAACAGAGGATGG + Intergenic
1044732482 8:95240494-95240516 GAAGGGTAGTTACCAGAGGGTGG - Intergenic
1044865886 8:96570891-96570913 GAACAGTGGTTACCGGGGGAAGG + Intronic
1045062474 8:98421910-98421932 GAGCAGGAGGCATCAGAGGAGGG + Intronic
1045238891 8:100380370-100380392 GAGCTGCAGTCCCCAGAGGAAGG - Intronic
1045264713 8:100609296-100609318 GGGGAGTAGGGACCAGAGGAGGG - Intronic
1045337455 8:101221032-101221054 GAATAGTGGTTACCAGAGGTGGG + Intergenic
1045521755 8:102909141-102909163 AAACAGTGGTTACCAGAGGCAGG + Intronic
1045705435 8:104916893-104916915 GAGCAGTAGTTACCTGGGGCAGG - Intronic
1045800004 8:106091228-106091250 GAATAGTGGTTACCAGAGAAGGG + Intergenic
1046346318 8:112932645-112932667 GAAAAATAGTTACCAGAGGCTGG + Intronic
1046632675 8:116636881-116636903 GAGCAGTGGTTCCCAAAGTATGG - Intergenic
1047059162 8:121203808-121203830 GATTAGTGGTTACCAGAGGCTGG + Intergenic
1047084428 8:121500369-121500391 TAGTAGTAGCTACCAGAGGCTGG + Intergenic
1047347286 8:124040488-124040510 AAGTAGTATTTTCCAGAGGAGGG - Intronic
1047615222 8:126557810-126557832 GAGGGGAAGTTAGCAGAGGAGGG - Intronic
1047783617 8:128132258-128132280 TACCAGTAGTCACCAGAGGTTGG + Intergenic
1048155348 8:131942942-131942964 GAGCAGTGGTTGCCTGAAGAGGG + Intronic
1048303392 8:133267307-133267329 CAGCAGTGGTTACCAGGTGAGGG + Intronic
1049136541 8:140906637-140906659 GAGTGGTGGTTACCAGAGGCTGG + Intronic
1050041067 9:1494276-1494298 GAGTGGTAGTTATCAGAGGCTGG - Intergenic
1050109995 9:2204996-2205018 GATCAGTAGTTACCTGAGGTTGG - Intergenic
1050422345 9:5478655-5478677 GGGTAGTGGTTACCAGAGGCTGG - Intergenic
1050822613 9:9899995-9900017 GAATAATAGTTACCAGAGGCTGG + Intronic
1050886147 9:10768768-10768790 AAACAGTAGTTACCAGAGTAGGG - Intergenic
1051058767 9:13021210-13021232 GAAGGGTAGTTACCAGAGGCTGG + Intergenic
1051201066 9:14624618-14624640 GAACAGTAGTTAGCAGAGACTGG + Intronic
1051272297 9:15367258-15367280 GATCAGTGGTTGCCAGAGGCTGG - Intergenic
1051322525 9:15923469-15923491 GATTGGTGGTTACCAGAGGATGG + Intronic
1051517098 9:17942129-17942151 GAATAGAAGTTACCAGAGGCAGG + Intergenic
1051599466 9:18858339-18858361 GTGCAGTGGTGACCTGAGGAGGG - Intronic
1051640909 9:19223801-19223823 GAGCAGGCGTTAGCAGAGGGAGG - Intergenic
1051903640 9:22069837-22069859 GAACAGTGGTTACCAGAGACTGG - Intergenic
1052305212 9:27000972-27000994 GACTAGTGGTTACCAGAGGCTGG - Intronic
1052482671 9:29051310-29051332 GATCAGTTGTTACCAAAGGTTGG - Intergenic
1052578860 9:30327539-30327561 GACTAGTAGTTGCCAGATGATGG - Intergenic
1052690489 9:31809765-31809787 AATCAGTGATTACCAGAGGAAGG + Intergenic
1052760434 9:32584845-32584867 GAATGGTAGTTACCAGAGGCTGG - Intergenic
1052926289 9:34019487-34019509 GAATGGTAGTTACCAGAGGCTGG + Intronic
1053193730 9:36097999-36098021 GAATAGTGGTTACCAGAGGGTGG + Intronic
1053438311 9:38092439-38092461 GAGCGGTAGTTACCAGGGGCTGG - Intergenic
1053584471 9:39442456-39442478 GAGCGGTAAGTACCTGAGGAAGG + Intergenic
1054106051 9:61001202-61001224 GAGCGGTAAGTACCTGAGGAAGG + Intergenic
1055207809 9:73753487-73753509 GAGTAGCAGTTACTACAGGATGG + Intergenic
1055345619 9:75334338-75334360 GAGCAGAGGATACCAGAGGCTGG + Intergenic
1055728124 9:79253293-79253315 GATTAGTAGTTACCAGAGGCTGG + Intergenic
1055746981 9:79458792-79458814 GACCAGTAGTCTCCAGAGCAGGG + Intergenic
1055821823 9:80274397-80274419 GATCAGTGGTTACAAGAGGCTGG + Intergenic
1055904276 9:81274735-81274757 GAATAGTGGTTACCAGAGGTTGG + Intergenic
1056171543 9:83990149-83990171 GAACAATGGTTACCAGAGGCTGG + Intronic
1056651154 9:88464476-88464498 GAGCAGTGGTTCCCAAAGCAAGG + Intronic
1056681537 9:88723291-88723313 GAATGGTAGTTACCAGAGGCTGG + Intergenic
1056727052 9:89128541-89128563 GAGATGAAGTTTCCAGAGGAAGG + Intronic
1057299224 9:93867276-93867298 GAACAGTGGTTACCAGAGACTGG - Intergenic
1057932147 9:99203859-99203881 GAAAAATAGTTACCAGAGGCTGG - Intergenic
1058377107 9:104335499-104335521 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1058403503 9:104644288-104644310 GAATGGTAGTTACCAGAGGCTGG + Intergenic
1058542460 9:106026077-106026099 GGGGAGTAGGTACCAGAGGCAGG - Intergenic
1058610288 9:106768927-106768949 AAGCAGTAGTTAATAGAGAAAGG - Intergenic
1058728729 9:107828749-107828771 GAACAGTAATTACCAGAGACTGG - Intergenic
1058923229 9:109638289-109638311 GACCAGTGGTTGCCAGAGGCTGG + Intergenic
1059023229 9:110598574-110598596 GAGATGGAGTTTCCAGAGGAAGG - Intergenic
1059509553 9:114831377-114831399 GAACAATGGTTACCAGAGAATGG - Intergenic
1059551235 9:115231589-115231611 GAGCATGAGTGAGCAGAGGAGGG - Intronic
1059940079 9:119350171-119350193 GAGCAGTTGTTCCCAGATGCTGG - Intronic
1060182683 9:121545305-121545327 GTACAGTAGGGACCAGAGGATGG - Intergenic
1060291738 9:122309053-122309075 GAATAGTAGTTACCAGGGGCTGG - Intronic
1060309957 9:122450764-122450786 GAACAGTGGTTAGCAGAGGAGGG - Intergenic
1060880485 9:127114636-127114658 GGGCAGTGCTGACCAGAGGACGG - Intronic
1062490824 9:136804115-136804137 GAGCAGGGGTTAGCAGATGACGG + Intronic
1185783931 X:2873746-2873768 GAACAGTAGTTGCCAGGGGCTGG - Intronic
1186238155 X:7535910-7535932 GAATGGTAGTTACCAGAGGATGG - Intergenic
1186620162 X:11232253-11232275 GAACGGTGGTTACCAGAGGGTGG - Intronic
1186880349 X:13859250-13859272 GATCAGTGGTTGCCAGAGGTTGG - Intronic
1186900978 X:14055672-14055694 GAACAGTGGTTACCAGAAGCTGG - Intergenic
1187256990 X:17652557-17652579 GAATAGTGGTTACCAGAGGCTGG + Intronic
1187612464 X:20957226-20957248 GAGAAGTAGTGACCAGAGGTAGG - Intergenic
1187717330 X:22115606-22115628 GAACAGTAGTTGCCAGGGGCTGG - Intronic
1187837603 X:23450702-23450724 CAGTAGTGGTTACCAGAGGCTGG + Intergenic
1187963907 X:24592063-24592085 GAACAGTGGTTACCAGAGGCTGG - Intronic
1188221893 X:27550698-27550720 GAATAGTAGTTACCAGAGGATGG - Intergenic
1188282128 X:28283093-28283115 GATCAGTAATTACCAGGGGCTGG - Intergenic
1188396277 X:29687473-29687495 GAATAGTGTTTACCAGAGGATGG + Intronic
1188442529 X:30227252-30227274 AAACAGTAGTTACCAGAGGCAGG - Intergenic
1188454422 X:30346523-30346545 GAACAATGGTTACCAGAGGCTGG + Intergenic
1188509967 X:30925218-30925240 GAACAGTTGTTATCAGAGGATGG + Intronic
1188891607 X:35618255-35618277 GAACAGTGGTTACCAGAGACTGG + Intergenic
1188975479 X:36668739-36668761 GACCTGTGGTTACCAGAGGCTGG + Intergenic
1189053151 X:37667951-37667973 GCTCACTAATTACCAGAGGATGG + Intronic
1189163041 X:38830772-38830794 GAACAGTGGTTACCAGAGGCTGG + Intergenic
1189527966 X:41846403-41846425 GAAGAGTGGTTACCAGAGGCTGG + Intronic
1189540936 X:41987785-41987807 AAACAGTAGTTACAAGAGGCTGG + Intergenic
1189862066 X:45282950-45282972 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1189929858 X:45997521-45997543 GATTAGTAATTACCAGAGGCTGG - Intergenic
1190156726 X:47999534-47999556 GACCAGTGGTTACTAGAGGCAGG + Intronic
1190531365 X:51380955-51380977 GAAAAGTGGTTACCAGAGGCAGG + Intergenic
1190806851 X:53845993-53846015 GAACAATGGTTACCAGAGGCTGG - Intergenic
1190879445 X:54482493-54482515 GAGCAGTAATTACCAGATGCTGG + Intronic
1191058402 X:56267970-56267992 GAATGGTAGTTACCAGAGGCTGG - Intronic
1192067978 X:67906351-67906373 GAACAATAATTACCAGAGGCTGG + Intergenic
1192336438 X:70224343-70224365 TAGCAGTGGTTGGCAGAGGAGGG + Intergenic
1192375096 X:70551238-70551260 GAGTGATGGTTACCAGAGGAGGG + Intronic
1192399884 X:70824502-70824524 CAGCAGTAGTTCCCACAGGATGG + Intronic
1192512976 X:71736612-71736634 GAGCAGGAGGCACCAGAGCAGGG - Intergenic
1192513721 X:71744897-71744919 GAGCAGGAGGCACCAGAGCAGGG + Intergenic
1192574410 X:72231380-72231402 GAACAGTAGTTACCAGAGGCTGG + Intronic
1192617081 X:72637229-72637251 GAACAGTGGTTGCCAGAGGCTGG - Intronic
1192619219 X:72660316-72660338 GATCAGTAGTTGCCAGAAGTTGG - Intronic
1192633483 X:72794902-72794924 GAGTAGTGGTTACCAGAAGCTGG - Intronic
1192648226 X:72925899-72925921 GAGTAGTGGTTACCAGAAGCTGG + Intronic
1192800912 X:74463951-74463973 GAGCAGTAGTTGCCAGACGATGG - Intronic
1192893284 X:75412887-75412909 CAACAGTGGTTACCAGAGGCAGG + Intronic
1193134525 X:77955806-77955828 GAACAGTGGTTACCAGAGACTGG - Intronic
1193143264 X:78051787-78051809 AAACAGTGGTTACCAGAGGTTGG - Intergenic
1193648103 X:84093155-84093177 GAATAGTGGTTACCAGAGGATGG + Intronic
1193756143 X:85410703-85410725 CAGCAGTGCTTACCAGAGAATGG - Intergenic
1193864237 X:86710335-86710357 GACCAGTGGTTGCCAGAGGATGG + Intronic
1194446686 X:93996114-93996136 GAAGGATAGTTACCAGAGGAAGG - Intergenic
1194453888 X:94079064-94079086 GAATAGTGGTTACTAGAGGAGGG + Intergenic
1194494587 X:94597476-94597498 GAACAGTAGTTATCTGAGGGAGG + Intergenic
1194898662 X:99478097-99478119 GAATAGTGGTTACCAGAGGCTGG - Intergenic
1195208911 X:102632214-102632236 GAATGGTGGTTACCAGAGGATGG + Intergenic
1195362642 X:104099089-104099111 GAACTGTGGTTACCAGAGGCTGG + Intergenic
1195926591 X:110031787-110031809 CAGTAGTAGTTACTAGAGGTGGG - Intronic
1196067412 X:111479696-111479718 GAACAGTGGTTACCAGAGACTGG - Intergenic
1196188434 X:112770025-112770047 GAATGGTGGTTACCAGAGGATGG + Intergenic
1196374766 X:115020944-115020966 GAATAGAAGTTACCAGAGGCTGG - Intergenic
1196914917 X:120523230-120523252 AAGCAGTGGTTTCCAGAGGCTGG + Intergenic
1196932309 X:120694429-120694451 GAATGGTAGTTACCAGAGGCTGG - Intergenic
1196961761 X:121011073-121011095 GAACAATGGTTACCAGAGGCTGG - Intergenic
1197000805 X:121437458-121437480 GAAGAGTGGTTACCAGAGGCAGG - Intergenic
1197078717 X:122385798-122385820 GAATAATAGTTACCAGAGGCTGG + Intergenic
1197354851 X:125425880-125425902 GAAGAATAGTTACCAGAGGCTGG + Intergenic
1197373350 X:125651617-125651639 GAATAGTGGTTACCAGAGGATGG - Intergenic
1197789326 X:130235861-130235883 GAACAATAGTTGCCAGAGGCTGG - Intronic
1198027827 X:132725989-132726011 GAGGGATAGTTACCAGAGGATGG + Intronic
1198090048 X:133319665-133319687 GGGCAGGAGTTAGCAGAGGTGGG + Intronic
1198368990 X:135973434-135973456 GTGCAGGAGTTCCCAGTGGAAGG - Intronic
1198555894 X:137792811-137792833 GAGATGAAGCTACCAGAGGAAGG + Intergenic
1198691388 X:139288660-139288682 GAGCAGTGCTGACCAGGGGAAGG + Intergenic
1198953034 X:142094701-142094723 GAGTGATAGTTACCAGAGGCTGG + Intergenic
1198971728 X:142289178-142289200 GATTAGTGGTTACCAGGGGATGG + Intergenic
1199007119 X:142713499-142713521 GAATAGTGGTTACCAGAGGCTGG + Intergenic
1199274466 X:145925393-145925415 AAACAGTGGTTACCAGAGGCTGG + Intergenic
1199490498 X:148394032-148394054 GAAAAGTAGATACCAGAGGCTGG + Intergenic
1199583569 X:149386715-149386737 GAACAGTAGTTCCCAAAGGAAGG + Intergenic
1199932566 X:152538797-152538819 TAGCAGAAGTTAGCAGAAGAAGG - Intergenic
1199943531 X:152647877-152647899 GAGAAGTAGTTACCAGGGTTTGG + Intronic
1200172242 X:154085727-154085749 GAATAGTAGTTGCCAGAGGGTGG + Intronic
1200174361 X:154102405-154102427 GAACAGTAGTTACCAGAGACTGG + Intergenic
1200334869 X:155339844-155339866 GAACAGTGGTTACCAGAGGCAGG - Intergenic
1200351597 X:155501377-155501399 GAACAGTGGTTACCAGAGGCAGG + Intronic
1200366011 X:155665093-155665115 AATCAGCAGTTACTAGAGGAAGG + Intronic
1201224196 Y:11801195-11801217 GAAAGGTAGTTACCAGAGGCTGG + Intergenic
1201915141 Y:19173274-19173296 GAGATGAAGTTTCCAGAGGAAGG + Intergenic
1202084030 Y:21116834-21116856 AAGCAGTGGTTACCAGAGGCTGG - Intergenic