ID: 984297566

View in Genome Browser
Species Human (GRCh38)
Location 4:177872814-177872836
Sequence CTGTTTTACCCAAAGAAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 225}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984297562_984297566 30 Left 984297562 4:177872761-177872783 CCTGCAGCTGTGCCTCAGACTTA 0: 1
1: 0
2: 0
3: 22
4: 210
Right 984297566 4:177872814-177872836 CTGTTTTACCCAAAGAAAGTTGG 0: 1
1: 0
2: 1
3: 15
4: 225
984297563_984297566 18 Left 984297563 4:177872773-177872795 CCTCAGACTTAGTAATTTCACAG 0: 1
1: 0
2: 0
3: 23
4: 292
Right 984297566 4:177872814-177872836 CTGTTTTACCCAAAGAAAGTTGG 0: 1
1: 0
2: 1
3: 15
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984297566 Original CRISPR CTGTTTTACCCAAAGAAAGT TGG Intronic
900567361 1:3340125-3340147 GTGTTTTACCCAAAGGAAATAGG - Intronic
900655580 1:3755178-3755200 CATTTTTACCGAAGGAAAGTAGG + Intronic
905824867 1:41020035-41020057 CTGTTTTTCCCAGAGAAAGCTGG + Intronic
907697103 1:56742462-56742484 CTGATTTAGTCAAAGAAAGTTGG + Intronic
909227711 1:73045888-73045910 CTGTTGTAGCTAAAGCAAGTGGG - Intergenic
910011103 1:82463350-82463372 CTGTTTTGTCCAAAGACAGAAGG - Intergenic
911793670 1:102050506-102050528 CTGTTTTACTTAAAAATAGTTGG - Intergenic
912767209 1:112425168-112425190 CTGTTTTACAGAAATAAAATTGG + Intronic
916337961 1:163694377-163694399 CTGTTTTAACAAAGGAAATTGGG - Intergenic
918686057 1:187417356-187417378 CTGTTTTTCCCAGAGTAAGATGG - Intergenic
921605065 1:217142026-217142048 CTGTCTTTCTCAAAGGAAGTAGG + Intergenic
921624651 1:217365284-217365306 ATGTTTTTCCCATACAAAGTTGG + Intergenic
922316096 1:224443568-224443590 CTGTTTTAGACAAAGCAACTGGG + Intronic
923530120 1:234806077-234806099 CTGATTCACCCAAAGGATGTGGG + Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
924844820 1:247756044-247756066 CAGTTTTACCCAATAAAAATGGG - Intergenic
1063275290 10:4560074-4560096 CTATTATACCTTAAGAAAGTTGG + Intergenic
1063982319 10:11464011-11464033 CTGTTTATACCACAGAAAGTTGG + Intronic
1065461455 10:25969621-25969643 ATATTCAACCCAAAGAAAGTAGG + Intronic
1067921038 10:50457925-50457947 CTGTTTCTTCCAAAGCAAGTTGG - Intronic
1068125751 10:52840288-52840310 CTAGTTGCCCCAAAGAAAGTGGG + Intergenic
1068545927 10:58345698-58345720 CTGATTTTCCCAAATAAATTTGG - Intronic
1071054642 10:81494921-81494943 CTGTCTTCCCCAAAAGAAGTCGG - Intergenic
1072937569 10:99728089-99728111 CTTTTTTACCAAAAGGAATTAGG + Intronic
1073238884 10:102040872-102040894 TTGATTTCCCCAAAGTAAGTAGG + Intronic
1074066732 10:110021982-110022004 CTGTTTTCCCAGTAGAAAGTTGG + Intronic
1074970448 10:118532297-118532319 AAGTTTTCCCCAAAGAAAGATGG + Intergenic
1078020545 11:7653015-7653037 GTGTTTTAGCCAAGGAAACTAGG + Exonic
1078311706 11:10250118-10250140 CAGTTTTACCCAAGGATATTTGG - Intronic
1079381635 11:19943417-19943439 CCTTTTAACCCAAAGAAATTTGG - Intronic
1079940385 11:26672991-26673013 ATAATTTACCCAAAGAATGTAGG + Intronic
1080298808 11:30760695-30760717 CTGTTTTCCTCAAACACAGTTGG + Intergenic
1081181845 11:39993336-39993358 CTGCTTAACCCCAAGAAATTTGG + Intergenic
1082767547 11:57181308-57181330 CTTTTTTTCCCAAAGAGAGGAGG - Intergenic
1082839536 11:57677709-57677731 CCCTTTTACCCACAGGAAGTTGG + Intronic
1085484364 11:76849379-76849401 TTGTCTTACCCAAACAGAGTTGG + Intergenic
1088600056 11:111465950-111465972 TAGTTTCACCCAAAGAAAGGAGG - Intergenic
1090073421 11:123563380-123563402 TTGTTTCACTCAAAGAAAGGAGG + Intronic
1090942601 11:131400883-131400905 ATGTTAGACCCAAAGAAAGCAGG - Intronic
1091083168 11:132692251-132692273 CTGTTGTTCACAAAGAAAGTGGG + Intronic
1092469975 12:8768987-8769009 GTGTTCTAGCCAAAGAAACTAGG - Intronic
1095688011 12:45057592-45057614 CAGTGATACGCAAAGAAAGTGGG - Intergenic
1095813100 12:46392432-46392454 CTGTGCTACCCAAAGAATATAGG + Intergenic
1097163087 12:57063527-57063549 CTGTTTGAACCAAATAAATTTGG - Intronic
1098453003 12:70641518-70641540 TTGTTTTAGCCAGTGAAAGTGGG + Intronic
1098738034 12:74132195-74132217 CTGTTTTACCCAAAGGACACAGG - Intergenic
1102423003 12:112818737-112818759 ATGTTTTCCCAAAAGAAAATTGG + Intronic
1106283634 13:28299680-28299702 GTCTTTGTCCCAAAGAAAGTAGG + Intergenic
1109044454 13:57391297-57391319 CTGTTTGAGCCAAAGAAATAAGG - Intergenic
1112117162 13:96368904-96368926 CACTTTTACACAAAGAAAGAGGG - Intronic
1113021416 13:105891568-105891590 ATGTTTTACCCCAAGACAATTGG - Intergenic
1113251698 13:108460434-108460456 CTCTTCTTCCCAAAGAAAGTTGG + Intergenic
1115084831 14:29501928-29501950 CCATTTTACCAAAAGAAAATAGG - Intergenic
1115888648 14:38002726-38002748 CTGTTTTTTCCAAAAGAAGTGGG - Intronic
1116666088 14:47777477-47777499 CTGTGTTTCCCAAAGAAACAGGG - Intergenic
1116845570 14:49862168-49862190 CTCGTTTACCCACAGACAGTCGG - Intergenic
1117209017 14:53476302-53476324 ATGTTTCACCCATGGAAAGTTGG - Intergenic
1117567332 14:57007926-57007948 CTGTTTTACACACAGCATGTAGG - Intergenic
1118593599 14:67419528-67419550 CTGCCTTCCCCAAAGAAAGCAGG + Intergenic
1121097976 14:91231115-91231137 CTGTTATAGCCATAGAAAATGGG - Intergenic
1126347889 15:47716230-47716252 CTGTGTAACCCAAGGAAAGAAGG - Intronic
1126982316 15:54258110-54258132 CTGATGGACCCAAAGAAAGTGGG - Intronic
1128654761 15:69452637-69452659 ATAATTTACCCAAATAAAGTGGG + Intergenic
1129950513 15:79585303-79585325 ATGTTTTAACCAACGAAAATTGG + Intergenic
1131378493 15:91944839-91944861 CTGTTGCACCCAAAAAAAGAGGG - Intronic
1134827590 16:17296959-17296981 CTCTTCTACCAAAAGAAACTCGG - Intronic
1135430787 16:22381292-22381314 CTCTTTTTCCCTAAGAAATTTGG + Intronic
1136122732 16:28150085-28150107 CTGGTTTACCCACAGTAAGCTGG + Intronic
1137879326 16:52030507-52030529 TTGTTTTAGCTAAAGTAAGTGGG - Intronic
1140906077 16:79410424-79410446 CTGATTTACTCATAGAAATTTGG - Intergenic
1144771697 17:17763084-17763106 CTGTTTTAGACAATGCAAGTTGG - Intronic
1145221174 17:21090268-21090290 CTATTTTACATAAGGAAAGTGGG + Intergenic
1149399089 17:56275618-56275640 CTGTTTTGGGCAAAAAAAGTAGG + Intronic
1149510003 17:57232712-57232734 AAGTTATACACAAAGAAAGTGGG + Intergenic
1149640259 17:58198346-58198368 CTGTTTTCCTCACAGAGAGTCGG + Intronic
1150924431 17:69517705-69517727 CTGTTTTACCCTACGGAAGATGG - Intronic
1150943676 17:69721373-69721395 CTGTTTTACTCACTGAACGTGGG + Intergenic
1153853026 18:9114188-9114210 CTCTTTTAGTTAAAGAAAGTGGG - Intronic
1154292377 18:13120911-13120933 TTATTTTACGCAAAGAAAGGTGG + Intronic
1156560519 18:38120183-38120205 ATGTTTTAAAAAAAGAAAGTGGG + Intergenic
1156759347 18:40568677-40568699 GTGTTTTGCCCAAAGATAGTGGG + Intergenic
1157020052 18:43770408-43770430 ATGTTTCACCCTAAGAAAGGGGG + Intergenic
1157179717 18:45486014-45486036 CAGTATTTCCCTAAGAAAGTAGG - Intronic
1158182261 18:54729656-54729678 CTGATTAACCCATAGAAAGCAGG + Intronic
1160096396 18:75877606-75877628 ATGTTATTCCCAAAGAAAATGGG + Intergenic
1163912197 19:20206083-20206105 CAGTATTAGTCAAAGAAAGTAGG + Intergenic
1164438530 19:28253304-28253326 CTGTTTTACCAAAAGAAGGATGG - Intergenic
925686829 2:6481792-6481814 CTGATGTCCCCAAAGAAAGGAGG + Intergenic
926498989 2:13629034-13629056 GTTTTCTACTCAAAGAAAGTTGG - Intergenic
926909088 2:17833140-17833162 CTTTTAAACCAAAAGAAAGTAGG + Intergenic
927635938 2:24816853-24816875 CTGTTTCACTCAAATAAACTGGG - Intronic
929719980 2:44358327-44358349 ATATTTTACCCGAAGAAAGGAGG + Intronic
930635414 2:53799408-53799430 CTGTTTTGCCCACAGGAAATGGG - Intronic
930924693 2:56802861-56802883 CTGCCTTTCCCAAAGAAAGGAGG + Intergenic
931706705 2:64952215-64952237 CTGTGGGACCCAGAGAAAGTGGG + Intergenic
932004485 2:67914580-67914602 CTATTTTACTCTAAGAAATTAGG - Intergenic
932319022 2:70807355-70807377 CTGTTTTGTCCAAATACAGTTGG + Intergenic
932765993 2:74470482-74470504 CTATTTTATACAAAGAGAGTTGG + Intergenic
932779451 2:74550730-74550752 CTGTTTTATATAAAGAAACTGGG + Intronic
934037815 2:88103355-88103377 CTGTTTAACCCAATGAAACTGGG + Intronic
935917632 2:107972876-107972898 CTGTTTTAGCCAAGTAAACTCGG + Intergenic
938409402 2:131051419-131051441 CTGTTTTTCCCCAACAAAGAAGG - Exonic
938508344 2:131911284-131911306 CTCTTTTTCCCTAAGAAAATAGG + Intergenic
939533237 2:143391314-143391336 CTGATTTATCCCAAGAAACTAGG - Intronic
939712334 2:145537996-145538018 ATGTTTTCCCTAGAGAAAGTTGG - Intergenic
939814667 2:146879319-146879341 CTTTTTTGCACAAACAAAGTAGG - Intergenic
940091360 2:149922792-149922814 CAGTTTTACCTTAATAAAGTAGG + Intergenic
942173750 2:173311422-173311444 CTGTTATAACAAAACAAAGTGGG - Intergenic
942549710 2:177102315-177102337 CGATTTTACCCAAAGTAACTGGG - Intergenic
943224143 2:185146375-185146397 CTTCTTTACACAAATAAAGTTGG - Intergenic
943337706 2:186638851-186638873 TTGTTTTAACCAAAGTAATTTGG + Intronic
943369134 2:186994820-186994842 AAGTTTTACCCAAAGAAAGAAGG + Intergenic
945797338 2:214381064-214381086 CTTTTTTTCCCCAGGAAAGTTGG + Intronic
1171156603 20:22880275-22880297 CTATCTCACTCAAAGAAAGTGGG + Intergenic
1171220226 20:23390387-23390409 TTGTATTTCCTAAAGAAAGTAGG - Intronic
1176763272 21:12983167-12983189 CTGGTTCTCCTAAAGAAAGTTGG + Intergenic
1176785149 21:13247279-13247301 CTCTTTTTCCCTAAGAAAATAGG - Intergenic
1177036130 21:16045307-16045329 CTGTTTTGCCAAAAGGAGGTTGG - Intergenic
1177057414 21:16324403-16324425 ATTTCTTACCCAAAGACAGTTGG + Intergenic
1177983187 21:27941037-27941059 CTCTTTTTCCCTAAGAAAATAGG - Intergenic
1178111847 21:29376776-29376798 CTGTTGTACCCAAAACAAGAAGG - Intronic
1180918032 22:19503160-19503182 CTGTTTTAAAAAAAGAAAGCAGG + Intronic
1181668881 22:24416631-24416653 CTGTTTTGCCCTAAGAATGAGGG + Exonic
1184453896 22:44598376-44598398 CTGTTTTACAGCAAGGAAGTTGG - Intergenic
949230023 3:1740145-1740167 TTGTTTTAGCCAAAGAAATGTGG - Intergenic
951506628 3:23453394-23453416 CTGTTTTTTAAAAAGAAAGTTGG + Intronic
952229926 3:31419209-31419231 GTCTTTTACCCAAAGAGTGTGGG + Intergenic
954926946 3:54244179-54244201 CACTTCTACCAAAAGAAAGTGGG - Intronic
955062924 3:55509133-55509155 ATATTTTAACCAATGAAAGTTGG + Exonic
955097916 3:55818102-55818124 CTGTTTTGCCAAAAGAAAGGAGG - Intronic
956035870 3:65091153-65091175 TTGTTTTTTCCAAACAAAGTTGG + Intergenic
957221912 3:77393320-77393342 GTGTTTTTCCAAAAGAAAATAGG - Intronic
957251955 3:77783366-77783388 CACTTTTACACAAAGGAAGTAGG - Intergenic
958053010 3:88372535-88372557 TTGTTTAACCCAAAGAAGGGAGG + Intergenic
960464159 3:117974864-117974886 ATGTTTTACCACAAAAAAGTTGG - Intergenic
960566940 3:119144054-119144076 CTATTTCACACAAAAAAAGTGGG - Intronic
962509814 3:136086761-136086783 TTGGTTTGGCCAAAGAAAGTTGG - Intronic
964223922 3:154375172-154375194 CTATTTAACCCAAATAAAATTGG - Intronic
964631269 3:158813111-158813133 TTTTTTTAACCAAAGTAAGTTGG + Intronic
965660773 3:171039790-171039812 CTGTTTTACCCATAGTAAAGAGG - Intergenic
965706089 3:171509608-171509630 ATGTCTGAACCAAAGAAAGTGGG - Intergenic
966120986 3:176520013-176520035 AGGTTTTGCCCAAAGAAAGTAGG + Intergenic
967503711 3:190229218-190229240 ATGTGGTACCCACAGAAAGTGGG + Intergenic
970237108 4:13969845-13969867 TTGTTTAACACAAAGAAAGGAGG + Intergenic
970703414 4:18770621-18770643 CTGTTTTACTAAATGTAAGTTGG + Intergenic
970740650 4:19233782-19233804 CAGTTTTACCTACAAAAAGTCGG - Intergenic
970877441 4:20887858-20887880 CTGTTTTAAACAAAGAAAGTAGG - Intronic
971488389 4:27185877-27185899 CCATTTTACCCAAATAAAGATGG - Intergenic
971625094 4:28909744-28909766 CTTTTATGCCCAGAGAAAGTTGG + Intergenic
976645976 4:87387726-87387748 ATTTTTTACCCACAAAAAGTAGG + Intronic
977322970 4:95543043-95543065 ATGTTTTACTCACAGAAACTTGG - Intronic
978716118 4:111844918-111844940 CTATTTAACCCAAAGGAAATAGG + Intergenic
982267884 4:153556663-153556685 CTGTGTTAGCTAAAGACAGTTGG + Intronic
982948954 4:161664165-161664187 ATGTTTTTCCCAAAGACAATTGG - Intronic
983079235 4:163364813-163364835 GTGTTTTACCTGAAGAAACTTGG - Intergenic
983616082 4:169706655-169706677 CTGTTATAAACAAAGAAAATTGG + Intronic
984297566 4:177872814-177872836 CTGTTTTACCCAAAGAAAGTTGG + Intronic
985179403 4:187240460-187240482 CAATTTTACCCAAAGAGAGATGG + Intergenic
987176087 5:15311910-15311932 GTGTTTGACCCAATGACAGTGGG - Intergenic
987195620 5:15523191-15523213 CTGTTTTACTCTAATAAACTCGG - Intronic
989127560 5:38071848-38071870 CTGTTATACCAAAACACAGTGGG + Intergenic
989321440 5:40139161-40139183 CTGTTTTCCCCAAAAAAACCTGG + Intergenic
989730710 5:44644705-44644727 TTGATTTACCCAAAGAAGATTGG + Intergenic
990149624 5:52801107-52801129 TTGTTTTACCTGAAGAAATTTGG - Exonic
993021985 5:82603153-82603175 ATCTTTCACCCAAAGAAACTAGG - Intergenic
993165240 5:84345299-84345321 CTATTTTCCACAAAGAAAGATGG + Intronic
993685348 5:90930562-90930584 CTTTTTTAACCAAAGAAAAAAGG + Intronic
994168141 5:96629368-96629390 CTGTTATAGCCACAGAAAATAGG + Intronic
996148505 5:120005815-120005837 CTGTGTTACTCAAAGAAAGGTGG + Intergenic
996595263 5:125194118-125194140 CTTTTTTACACAAATAAAGCTGG - Intergenic
997848579 5:137310653-137310675 CTGTTCCACTCAAACAAAGTGGG + Intronic
997933037 5:138087689-138087711 CTCTTAAACCCAAAGGAAGTGGG + Intronic
998983247 5:147727306-147727328 CTGTTTTGCCCAGCTAAAGTAGG + Intronic
999747320 5:154602356-154602378 CTGTTTTACCCAAAGTCTGTTGG - Intergenic
1001200304 5:169709984-169710006 TTGTTTTAGCCAAAGCAGGTGGG + Intronic
1005633923 6:27735262-27735284 CAGTTCTAGCCACAGAAAGTAGG - Intergenic
1006731675 6:36240701-36240723 CTGTTTTAGACAAAGAAGCTGGG + Intergenic
1007973878 6:46080528-46080550 CTGGCTTACCCAAAGAATCTTGG - Intergenic
1008362756 6:50641194-50641216 CTGTTATACGCAAATACAGTGGG + Intergenic
1008698206 6:54066870-54066892 ATGTTTTATCCAAAAAAAATGGG + Intronic
1009832859 6:68961192-68961214 CTGTTGTGCACAAAGAAAGATGG + Intronic
1010122899 6:72399749-72399771 CTGTTTTACACAAGCAGAGTTGG - Intronic
1011106306 6:83785550-83785572 TTGCTTTACAGAAAGAAAGTGGG - Intergenic
1011985762 6:93443121-93443143 CAGTTTTAGCCAAAGCAATTAGG - Intergenic
1012131528 6:95499524-95499546 CTGTTTAAAACATAGAAAGTTGG + Intergenic
1016083985 6:139889870-139889892 CTCTTTTATCCAAAGAAAAAAGG - Intergenic
1016260302 6:142161086-142161108 CTATTTGACCCAAAAAAAGGGGG - Intronic
1017520923 6:155201560-155201582 GTGCTTAACCCAAAGAAAGAAGG - Intronic
1018089435 6:160333003-160333025 CTGGTTTACCCTATGAAATTGGG + Intergenic
1018404904 6:163469652-163469674 CTGTTTTACTGAAAAACAGTGGG + Intronic
1018709899 6:166490879-166490901 CTGTTGTACCCCAAGCACGTAGG - Intronic
1021588910 7:22239824-22239846 CTGTATTACCCCAAGCCAGTGGG - Intronic
1022853025 7:34284559-34284581 TTGTTTAACCCAAAGGAATTTGG + Intergenic
1025951574 7:66149811-66149833 TTTTTTTCCCCAAAGAGAGTGGG + Intronic
1027839294 7:83287718-83287740 TTGTTTTACTCAGAGAAATTTGG - Intergenic
1028269748 7:88773997-88774019 CTGTTTTATCCAAAGGAGTTTGG - Intronic
1028747848 7:94347737-94347759 CGGTTGAACCCATAGAAAGTTGG + Intergenic
1029904844 7:104081429-104081451 CATTTTTACCCTAAGAAAATTGG + Intergenic
1030474383 7:110010949-110010971 CTTTTTTACCAACAGAAAGTAGG - Intergenic
1033202524 7:139385659-139385681 CAGTTATTCCCAAACAAAGTAGG + Intronic
1034000873 7:147411636-147411658 CTGATTTTCATAAAGAAAGTAGG + Intronic
1038094720 8:24295355-24295377 TTATTTTACCAAAAGAAAGCTGG - Intronic
1039552553 8:38453594-38453616 CTGTTATACCTAAATTAAGTTGG + Intronic
1042387101 8:68189316-68189338 AGGTTTTACCCTAAGCAAGTTGG - Intronic
1044327348 8:90874733-90874755 CTGTTTTTCCCATGGAAGGTTGG - Intronic
1046581148 8:116093870-116093892 CTCTCTTCCCCTAAGAAAGTGGG + Intergenic
1047242906 8:123109424-123109446 CAGTTTTACTCAAAAAAAATTGG + Intronic
1047867919 8:129049283-129049305 CTGTTTTACGCAAACACATTCGG + Intergenic
1049123623 8:140764967-140764989 GTGTATTACCCAAAAAGAGTAGG - Intronic
1050705476 9:8391874-8391896 CATTTTTACCCAAAGAGGGTTGG - Intronic
1052508716 9:29386790-29386812 CTTTTTTACCTCAAGAAACTAGG - Intergenic
1053572419 9:39322915-39322937 CTGTTGTAAGCAAAGAAAGGAGG - Intergenic
1053623800 9:39847445-39847467 CTGTTGTAAGCAAAGAAAGGAGG - Intergenic
1053687491 9:40550965-40550987 CTGGTTCTCCTAAAGAAAGTTGG - Intergenic
1053712143 9:40826726-40826748 CTGGTTCTCCTAAAGAAAGTTGG - Intergenic
1053881068 9:42595783-42595805 CTGTTGTAAGCAAAGAAAGGAGG + Intergenic
1053939306 9:43214467-43214489 CTGGTTCTCCTAAAGAAAGTTGG - Intergenic
1054093980 9:60881627-60881649 CTGTTGTAAGCAAAGAAAGGAGG - Intergenic
1054115454 9:61157547-61157569 CTGTTGTAAGCAAAGAAAGGAGG - Intergenic
1054124726 9:61296096-61296118 CTGTTGTAAGCAAAGAAAGGAGG + Intergenic
1054220097 9:62403254-62403276 CTGTTGTAAGCAAAGAAAGGAGG + Intergenic
1054230618 9:62505918-62505940 CTGTTGTAAGCAAAGAAAGGAGG - Intergenic
1054276259 9:63075539-63075561 CTGGTTCTCCTAAAGAAAGTTGG + Intergenic
1054398573 9:64689392-64689414 CTGGTTCTCCTAAAGAAAGTTGG - Intergenic
1054422681 9:64959976-64959998 CTGGTTCTCCTAAAGAAAGTTGG - Intergenic
1054592302 9:67024995-67025017 CTGTTGTAAGCAAAGAAAGGAGG + Intergenic
1059572395 9:115453308-115453330 CTAATTTACGCAAAGTAAGTTGG - Intergenic
1059671682 9:116497945-116497967 GTGTTTGGCCCAGAGAAAGTTGG - Intronic
1059726535 9:117014034-117014056 TATTTTTACCCAAAGAAAGAGGG - Intronic
1060607602 9:124930609-124930631 CTGTTTTACTCCAATAAAATGGG + Intronic
1185856236 X:3538800-3538822 CTGTTTTTCACAATGGAAGTTGG - Intergenic
1189397353 X:40634896-40634918 CTGTTTTACAGAAAGGAAATAGG - Intronic
1190421098 X:50285355-50285377 CTGGTTTAACCTGAGAAAGTGGG + Intronic
1194938119 X:99976291-99976313 ATTTTTTACCAAAAGAAATTGGG + Intergenic
1195351577 X:104001391-104001413 CAGTTTTACACAAGAAAAGTTGG + Intergenic
1197013590 X:121596920-121596942 CTCTTCTACCCACAGAATGTAGG - Intergenic
1197891461 X:131274378-131274400 CTCTTTTCCCCAAGGAAAGGAGG - Intronic
1197908636 X:131455365-131455387 CTGTCTCACCTAAAGAAGGTAGG + Intergenic
1198024335 X:132690444-132690466 CTGTTTATCCCAGAGAATGTAGG + Intronic
1198603323 X:138308829-138308851 CAGTTTTGCCTATAGAAAGTAGG + Intergenic
1198984638 X:142435424-142435446 CAGTTTTAACCAGAGCAAGTGGG + Intergenic
1200379700 X:155822151-155822173 CTCTTTTACACAAAGAAGGAAGG + Intergenic