ID: 984303246

View in Genome Browser
Species Human (GRCh38)
Location 4:177951622-177951644
Sequence GTGTGTGAGTGGCAGGTGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 767
Summary {0: 1, 1: 0, 2: 29, 3: 55, 4: 682}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984303246_984303251 2 Left 984303246 4:177951622-177951644 CCCAACACCTGCCACTCACACAC 0: 1
1: 0
2: 29
3: 55
4: 682
Right 984303251 4:177951647-177951669 GGATTTACTCTGTAGATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984303246 Original CRISPR GTGTGTGAGTGGCAGGTGTT GGG (reversed) Intronic
900123160 1:1058205-1058227 CTGTGTGCCTGGCAGGTGTCAGG + Intergenic
900683031 1:3928242-3928264 TTCTGTCACTGGCAGGTGTTGGG - Intergenic
900780840 1:4616225-4616247 GTGTGTAGGTGGCATGTGCTCGG + Intergenic
900942418 1:5808802-5808824 GAGTGTGAGTGGCAAGTGAGTGG - Intergenic
901168635 1:7237727-7237749 GTCTGTGAGCTGCAAGTGTTTGG + Intronic
901206474 1:7500454-7500476 GTGTGTGAGCCTCTGGTGTTTGG + Intronic
901215117 1:7550743-7550765 GGGTGGGAGGGGCAGGTGTCAGG - Intronic
901407684 1:9060642-9060664 GTGTGTGTGTGGGGGGTGTGTGG - Intronic
901559690 1:10060079-10060101 GTGTGTGTGTGGAGGGGGTTGGG + Intronic
901633579 1:10659394-10659416 GTGTGTGGGTGGCGTGTGTGGGG + Intronic
901685551 1:10941636-10941658 GTGTGTGATTGGCAGGTTTACGG - Intergenic
902400467 1:16154364-16154386 GTTGGGCAGTGGCAGGTGTTGGG - Intronic
902647674 1:17813258-17813280 CTATGTGAGTTGTAGGTGTTTGG + Intronic
902679561 1:18033547-18033569 GTGTGTGGGGTGCAGGGGTTGGG + Intergenic
902712172 1:18247948-18247970 GTGTGTGTGGGGCTGGAGTTTGG - Intronic
903461128 1:23521739-23521761 GGGTGTGAGTGGCAGGGGCGGGG - Intronic
903572754 1:24318580-24318602 GTGTGTTGGTGGCAGGGGGTGGG - Intergenic
903771831 1:25769147-25769169 GTGTGTGTGTGGAATGTGTGAGG - Intronic
904116065 1:28162919-28162941 GTGTGTGGCTGGCAGTTGTTGGG - Intronic
904801676 1:33097483-33097505 GCCTGTGAGTGACAGGTGTCAGG + Intronic
905720922 1:40201046-40201068 GTGTGTGTGTGTGAGGTGTGGGG - Intronic
905944265 1:41888715-41888737 GTGTGTGTGTGGTATGTGTGTGG - Intronic
906793470 1:48678414-48678436 GTGTGTGAGTGGAAGGGACTGGG - Intronic
907309200 1:53529726-53529748 CTGAATGAGTGGCAGGTGTGTGG + Intronic
908444238 1:64186888-64186910 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
908696313 1:66845846-66845868 GTGTGTGTGTGGTGGGGGTTGGG + Intronic
908807033 1:67942528-67942550 GTGTGTGTGTGTCAGGGGTGGGG - Intergenic
909519564 1:76551827-76551849 GTGTGTGTGTGGTGGGGGTTGGG - Intronic
910091779 1:83473002-83473024 GTTTGTGAGTGGTAGGTGGTGGG - Intergenic
911946492 1:104115737-104115759 GTGTGTGTGTGTGTGGTGTTAGG + Intergenic
912470126 1:109901119-109901141 GAGTGTGAGTGGCAGAGGGTTGG - Intergenic
912499764 1:110114105-110114127 GTGTGTGAGTGGGAGGGAGTGGG + Intergenic
913301657 1:117376537-117376559 GTGGGTGAGTGGCAGGTAGTTGG - Intronic
913456559 1:119037787-119037809 GTGTATGAGAGGGAGGTGTCAGG - Intronic
913489685 1:119367420-119367442 GTGAGTGAGTGGCTGCAGTTTGG + Intergenic
914747872 1:150512694-150512716 GTGTGAAAGGGGCAGGGGTTAGG - Intronic
914915965 1:151819463-151819485 GTGTTGGAGGGGGAGGTGTTGGG - Intronic
915299407 1:154943556-154943578 GTGTGGGTGGGGCAGGGGTTAGG - Intergenic
915523749 1:156463956-156463978 GTGGGTGATTGTCAGGTGTGGGG + Exonic
919604652 1:199667061-199667083 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
919928287 1:202204402-202204424 GTGTGTGTGTGGTGTGTGTTTGG - Intronic
920045754 1:203131201-203131223 GAGCGTGAGTGGCAGGAGTAGGG - Intronic
920311194 1:205049271-205049293 GTGTGTGTGTGTCGGGTGTGAGG - Intronic
920440120 1:205975344-205975366 GTGTGTGTGTGGTATGTGTATGG - Intergenic
920558811 1:206924101-206924123 GTGTGTGAGTGTGTGGTGTGTGG + Intergenic
920558841 1:206924680-206924702 GTGTGTGAGTGTGTGGTGTGTGG + Intergenic
921254825 1:213329835-213329857 CTGTGTGACTGGGAGGGGTTGGG - Intergenic
922325807 1:224527156-224527178 GTGTGTGGGGGACAGGTGCTTGG + Intronic
923196061 1:231668786-231668808 GTTTGAGACTGGCTGGTGTTTGG + Intronic
923270845 1:232353849-232353871 GAGGGTAGGTGGCAGGTGTTTGG - Intergenic
923678681 1:236101691-236101713 GTGTGTGAGTGCTATGTGTGTGG + Intergenic
923704928 1:236336373-236336395 GTGTGGGAGGTGCAGGAGTTGGG + Intergenic
924089217 1:240485583-240485605 GTGTGTTAGGGGTAGGTGTGGGG - Intergenic
924581665 1:245329314-245329336 TTGTGTTAGTGGCAGATGATGGG - Intronic
1063157845 10:3396564-3396586 GTCTGTGAGTGACAGGTGAGTGG - Intergenic
1063352280 10:5366625-5366647 GTGTGTGAGTGGCTGGGGGCTGG - Intronic
1063379778 10:5577168-5577190 GTGTGTGCGGGGCATGTGTGTGG - Intergenic
1063379819 10:5577365-5577387 GTGTGTGCGGGGCATGTGTGTGG - Intergenic
1063379835 10:5577433-5577455 GTGTGTGCGGGGCATGTGTGTGG - Intergenic
1063457113 10:6191629-6191651 GAGTTTGAGTCGCAGCTGTTGGG + Intronic
1064498667 10:15943997-15944019 GTTTCTGTGGGGCAGGTGTTTGG + Intergenic
1065315208 10:24457368-24457390 GTGTGTGGGTGGCGGGGTTTGGG + Intronic
1066732671 10:38449370-38449392 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1067438880 10:46297071-46297093 GTCTCTGGGTGGCAGGTGCTTGG + Intronic
1067525575 10:47036347-47036369 GAGAGTGAGGGGCAGGTGTCAGG + Intergenic
1067575631 10:47406610-47406632 GTCTCTGGGTGGCAGGTGCTTGG + Intergenic
1067734893 10:48842807-48842829 GAGTGTGACTGGCAGGAGATAGG - Intronic
1067801326 10:49361328-49361350 GTGCGAGACTGGCAGGTGGTTGG - Intergenic
1067817731 10:49495320-49495342 GTGTGTGAGAGGCAGGCGTGTGG - Intronic
1068049713 10:51934262-51934284 GCGTGTGTGTGGGCGGTGTTGGG - Intronic
1068629428 10:59284547-59284569 GTGTGTATGTGGCAGGGGTGGGG - Intronic
1068849378 10:61719472-61719494 GTGTGTGTGTGGAGGGTGTGGGG - Intronic
1069690434 10:70348252-70348274 CTGTGTTAGTGGCTGGTGATGGG - Intronic
1069828711 10:71269932-71269954 ATGTGTGTGTGGGAGGGGTTGGG + Intronic
1069833791 10:71296334-71296356 GTGTGTGTGTGTCAGGGGCTAGG - Intronic
1070548478 10:77472071-77472093 GTGTGTGTGTGGTATGTGTATGG - Intronic
1070554412 10:77516800-77516822 CTGTGTGAGCGGCTGGTGTGGGG + Intronic
1070805692 10:79269440-79269462 GTGTGTTGGGGGGAGGTGTTGGG - Intronic
1072004235 10:91227763-91227785 ATGTGTGAGTGTTAGGTGGTAGG - Intronic
1072177239 10:92939419-92939441 ATGTGTGTGTGGCAGGGGTGGGG + Intronic
1073061204 10:100734942-100734964 CTGTGAGTGTGGCAGGAGTTTGG + Intergenic
1073439931 10:103546503-103546525 GTGGCAGAGGGGCAGGTGTTGGG + Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074283470 10:112075674-112075696 GTGTGTAGGTGGCTGGTGTTTGG + Intergenic
1074372729 10:112913366-112913388 GTGTGTGAGGGGTGGGTGTGTGG + Intergenic
1074629839 10:115240024-115240046 GTGTGTGTGAGGCAGGCGTGAGG + Intronic
1075038039 10:119085671-119085693 GTGTGTGAGTGGCTGAGGTAAGG - Intergenic
1075903143 10:126059314-126059336 GGATGTTAGTGGCAGGGGTTAGG - Intronic
1075957444 10:126536180-126536202 GTGTGTGTGTGGAGGGGGTTGGG - Intronic
1076243945 10:128931881-128931903 GTGTGTGGGGGGCAGGGATTGGG + Intergenic
1076858938 10:133130730-133130752 GTGTGTGATATGCACGTGTTTGG - Exonic
1076858940 10:133130825-133130847 GTGTGTGATATGCACGTGTTTGG - Exonic
1076900975 10:133337241-133337263 GTGTGTGTGTGTCAGGTGTTTGG - Intronic
1076901137 10:133338380-133338402 GTGTGTGTATGTCAGGTGTGTGG - Intronic
1077074495 11:694288-694310 AGGTGTGCGGGGCAGGTGTTTGG + Intronic
1077784043 11:5363228-5363250 GTGTGTGTGTGTGAGGGGTTGGG - Intronic
1079009444 11:16816299-16816321 GGGAGTGAGTGGCAGAGGTTTGG - Intronic
1079073530 11:17368464-17368486 GTGTGTGGGTGGCATGTGCAGGG + Intronic
1079213258 11:18483034-18483056 GTGTGTGTGTAGCAGGGGGTGGG + Intronic
1079815685 11:25054488-25054510 GTGTGTCTGTGGATGGTGTTAGG + Intronic
1080007298 11:27423431-27423453 GTGTGTGTGGGGTATGTGTTTGG - Intronic
1080190617 11:29542904-29542926 GTGTGTGGGTGGGAGTAGTTTGG + Intergenic
1080216479 11:29847652-29847674 GTGTGTGTGTGGCAGGGATAAGG - Intergenic
1080451847 11:32384488-32384510 GTGTGTGGGTGGGTGGTGGTCGG - Intergenic
1080882474 11:36335408-36335430 GTGTGTGTGTGTGTGGTGTTTGG + Intronic
1081606838 11:44532419-44532441 GTTGGTGAGTGGCAGATGCTGGG + Intergenic
1081650524 11:44820710-44820732 GTGGTGGAGTGGAAGGTGTTTGG + Intronic
1081670901 11:44942057-44942079 GTGTGTGTGTGGTATGTGTGTGG - Intronic
1082737543 11:56873493-56873515 GTGTATGTGTGGCAGGAGTGAGG + Intergenic
1083200213 11:61116606-61116628 GTGTGTGTGTGGTATGTGTGTGG - Intronic
1083273235 11:61582498-61582520 GTGTGTGTGTGGTGGTTGTTGGG - Intergenic
1084166959 11:67379574-67379596 GTGTCTGAGTGACGGGTGTGTGG + Intronic
1084381700 11:68816991-68817013 GTGTGTGTGTGGTATGTGTGGGG + Intronic
1084397873 11:68925889-68925911 GTGTGTGATTATCATGTGTTAGG + Intronic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1084937820 11:72596396-72596418 GTGTGGGGGTGGGAGGAGTTGGG - Intronic
1085408123 11:76276157-76276179 GTGTGTGGGTTGCGTGTGTTGGG - Intergenic
1085412624 11:76300569-76300591 GTGTGTGTGTGACTGGTGTATGG + Intergenic
1086208770 11:84293131-84293153 GTGTGTGTGTGTCGGGTGTGGGG + Intronic
1087398111 11:97628405-97628427 GTGTATGAGTGTTAGGGGTTGGG - Intergenic
1088624700 11:111721354-111721376 GTGTGTGTGTGGCAGGAGAAGGG - Intronic
1088820424 11:113452012-113452034 GGGTGTGAGTTGAATGTGTTGGG - Intronic
1089013069 11:115146040-115146062 GTGTGTGTGTGGTATGTGTGTGG + Intergenic
1089762872 11:120741022-120741044 GTGTGTGAGGGGCAAGTTTCTGG + Intronic
1090287745 11:125514700-125514722 GTGTGTGTGTGGCGGGGGGTGGG + Intergenic
1090942612 11:131400968-131400990 GTGTGTGTGTGGCAGGTGGCAGG - Intronic
1091119502 11:133045114-133045136 ATGTGTGAGGGGCAGGGATTGGG - Intronic
1091337279 11:134781877-134781899 GTGATTGATTGGCAGGTGCTGGG + Intergenic
1091340202 11:134806220-134806242 GTGTGAGAGTCACAGGTGTCAGG + Intergenic
1091911541 12:4234567-4234589 GTGTGTGGATGGCAAGAGTTGGG - Intergenic
1093650208 12:21634460-21634482 GTGTGTGACTGGCATTGGTTGGG + Intergenic
1094057225 12:26279786-26279808 CTTTGTGAGAGGCAGGTGGTAGG - Intronic
1094745955 12:33344797-33344819 GGGAGTGAGTGGCAGTTGTGAGG - Intergenic
1095052438 12:37566669-37566691 GTGCGTGAGTTGCAGGTCTGTGG + Intergenic
1095054270 12:37581571-37581593 GGCTTTGAGTGGCAGGTGTGCGG + Intergenic
1096465977 12:51848072-51848094 GTGTGTGTGTGGGAGGGGTGGGG - Intergenic
1096677558 12:53233779-53233801 GTGTGGGAGGGGCGGGTGTCAGG + Intergenic
1097140235 12:56896537-56896559 GTGTGTGTGGTGCATGTGTTGGG - Intergenic
1097184957 12:57191609-57191631 GTGTGTGTGTGGTATGTGTAGGG - Intronic
1097184990 12:57191827-57191849 GTGTGTGTGTGGTATGTGTGTGG - Intronic
1097185016 12:57192087-57192109 GTGTGTGTGTGGCATGTTTGTGG - Intronic
1097190834 12:57218670-57218692 GTGTGTGAGCTGCAGCTGTGGGG + Intronic
1097539943 12:60928442-60928464 GTGTGTGTGTGGCCGGGGGTGGG + Intergenic
1098369015 12:69738419-69738441 GTGTGTGTGTGGCGGGAGATGGG - Intergenic
1099443033 12:82721245-82721267 GTCTGTCAGTGGCAGCTGCTGGG + Intronic
1099881390 12:88471066-88471088 GTTTGTTACTTGCAGGTGTTTGG + Intergenic
1100291967 12:93224233-93224255 GTGTGTGTGTTGCAGGGGCTGGG + Intergenic
1100370503 12:93964918-93964940 GTCTGTGAGTGGCAGAACTTTGG + Intergenic
1101673079 12:106894957-106894979 GTGAGTGAGTGGCAAGTGAATGG - Intergenic
1101845967 12:108363205-108363227 GTGTGTGTGTGGCATGTGTGGGG + Intergenic
1101845980 12:108363326-108363348 GTGTGTGTGTGGCATGTGTGTGG + Intergenic
1102009197 12:109607603-109607625 GTGTGTGTGTGGCGGGGGTGGGG - Intergenic
1102045788 12:109829509-109829531 GTGGGTGGGTGGAAGGTATTGGG - Intronic
1102187600 12:110961412-110961434 GTGTGTGTGTGGCATGTGCGTGG - Intergenic
1102349291 12:112180182-112180204 GGGTGGGAGAGGCAGGTGTGTGG + Intronic
1102943179 12:116961923-116961945 GGGTGTGAATGTGAGGTGTTGGG + Intronic
1103797253 12:123512747-123512769 GTGTGTGTGTGGTATGTGTGAGG + Intronic
1104097959 12:125576882-125576904 GTGTGTGTGTGGCAGGGGGGTGG + Intronic
1104298805 12:127543665-127543687 GTTAGTGATTGGCAGGTGCTGGG - Intergenic
1104759868 12:131290339-131290361 GTGTGTGCATGGCATGTGTGTGG - Intergenic
1104820860 12:131676910-131676932 GTGTGTGCATGGCATGTGTGTGG + Intergenic
1104878861 12:132055462-132055484 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1104878867 12:132055502-132055524 GTGTGTGTGTGTGAGGTGTAGGG + Intronic
1105474616 13:20719476-20719498 ATGTGTGTATGGCAGGTGTGTGG - Intronic
1106408065 13:29491075-29491097 GTGTGTGTGTGGTATGTGTGCGG + Intronic
1106463851 13:29995510-29995532 GTGTGTGAGGGGCAGGAGGTGGG + Intergenic
1106533514 13:30617693-30617715 ATGTGTGAGTGGCTGGGTTTGGG - Intronic
1106632026 13:31484493-31484515 GTGTGTCAGTGGCATGGGATAGG + Intergenic
1107022508 13:35766102-35766124 GTGTGGGAGCGGCAGTGGTTAGG + Intergenic
1107290918 13:38852121-38852143 GTGGGGGAGTGGCAGGAGGTGGG - Intronic
1107675650 13:42794022-42794044 GTGTGTTAGGGGCATGTGGTAGG - Intergenic
1107964841 13:45589080-45589102 GTGTGTGACAGGCAAGGGTTGGG - Intronic
1108644425 13:52412291-52412313 GTCAGTAAGTGGAAGGTGTTGGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1109061594 13:57629131-57629153 GTGTGTGTGTGTCGGGGGTTGGG + Intergenic
1109174040 13:59133353-59133375 GTGTGAGGGTGGCAGAGGTTGGG - Intergenic
1109794697 13:67295454-67295476 TTGTGTGTGTGTCTGGTGTTAGG + Intergenic
1110703465 13:78577319-78577341 GTGTGTGTGAGGCAGGGGTTAGG - Intergenic
1111094510 13:83495010-83495032 TTGTGTGTGTGGCGGGTGTGGGG - Intergenic
1111227568 13:85294460-85294482 GTGTGTGAGTGGCAGGTAGCTGG + Intergenic
1112436958 13:99397476-99397498 CTGTGGGTGTGGCTGGTGTTAGG - Intergenic
1112818638 13:103304389-103304411 GTGTGTGTGTGTTATGTGTTGGG - Intergenic
1112883304 13:104135847-104135869 GTGTGTGTGTGGCGGGTGTGGGG + Intergenic
1112917755 13:104572206-104572228 GTGTGTGAGAGGCAGGTGCTGGG - Intergenic
1113314939 13:109168865-109168887 GTGTATGAGTGGAAGGGGCTCGG + Intronic
1113428735 13:110230977-110230999 TGATGTGGGTGGCAGGTGTTGGG - Intronic
1113795839 13:113057573-113057595 GTGTTTGAGTGGTGTGTGTTTGG + Intronic
1114190920 14:20438858-20438880 ATGTTTGTGTGGCAGGGGTTGGG - Intergenic
1115212714 14:30983971-30983993 GTGTCTGAGAGGCAGGTACTAGG + Intronic
1115835090 14:37393416-37393438 GTGTGTGTGTGGCGGGGGTGGGG + Intronic
1116299503 14:43159485-43159507 GTGTTTGAGTGCCAGGTGTTTGG - Intergenic
1116385161 14:44321198-44321220 GTGTGTGTGTGGTGGGTGTGTGG + Intergenic
1116676518 14:47912693-47912715 GTGTGTGTGTGGCGGGGGGTGGG + Intergenic
1117881178 14:60315051-60315073 CTGTGAGTGTGGCAGGTGCTCGG + Intergenic
1118911217 14:70063603-70063625 GTGTCAGGCTGGCAGGTGTTAGG + Intronic
1119554891 14:75545755-75545777 GTGTGTGGGTGGGAGGTGGCGGG - Intronic
1119606927 14:76027327-76027349 GTGTGTGTGTGGGGGGTGTTGGG - Intronic
1119730841 14:76950286-76950308 GTGTGTAGGGGGCAGGTGGTGGG + Intergenic
1119765592 14:77185612-77185634 GTGTCTGAGTGGCAGTGATTTGG + Intronic
1121103819 14:91267801-91267823 ATGTGTATGGGGCAGGTGTTGGG + Intergenic
1121119747 14:91369224-91369246 GGGTGTGATTGGCTGGGGTTGGG - Intronic
1121410934 14:93747730-93747752 GTGTGCGAGTGGGAAGTGTGTGG + Intronic
1121576528 14:94993298-94993320 CTGACTGAGAGGCAGGTGTTTGG - Intergenic
1122253111 14:100454350-100454372 GTATGTGTATGGCAGGTGTGAGG + Intronic
1122350543 14:101087428-101087450 GTGTGTGTGTTGCAGGGGTAAGG + Intergenic
1122463726 14:101916689-101916711 GGGTGTGAGGGGCAGGGGTGAGG + Intronic
1122842235 14:104471612-104471634 GTGTGTGTGTGGCGTGTGTGGGG - Intergenic
1123037578 14:105477766-105477788 GTGTGTGAGAGGAAGGTGTGTGG + Intronic
1123055889 14:105569962-105569984 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123055971 14:105570913-105570935 GTGTATGAGTGGGTGGTGTGTGG - Intergenic
1123080216 14:105689078-105689100 GTGTGTGAGTGTCTGATGTATGG - Intergenic
1123080352 14:105690490-105690512 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1123080386 14:105690829-105690851 GTGTGTGAGTGTGTGGTGTATGG - Intergenic
1202840060 14_GL000009v2_random:113540-113562 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1202909444 14_GL000194v1_random:103737-103759 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1202883835 14_KI270722v1_random:85539-85561 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1124159951 15:27259304-27259326 GGGAGTGAGTGGCAGATGTCAGG - Intronic
1124493555 15:30173099-30173121 GTGTGTGTGTGGCATGTAGTAGG + Intergenic
1124493564 15:30173189-30173211 GTGTGTGTGTGGCATGTAGTAGG + Intergenic
1124517124 15:30376142-30376164 GTGTGTGAGTGGTGTGTGTGAGG + Intronic
1124653363 15:31488569-31488591 GTGTGTGACTCCCAGGTGTGGGG - Intronic
1124707297 15:31976543-31976565 GTGTGTGTGTGGTATGTGTTTGG + Intergenic
1124725820 15:32154856-32154878 GTGTGTGAGTGGTGTGTGTGAGG - Intronic
1124907845 15:33888307-33888329 GTGTGTGTGTGGCAGGGGGAAGG + Intronic
1125270251 15:37930881-37930903 GTGTGTGAGTGGCTGAAGTCTGG - Intronic
1125673172 15:41487817-41487839 GTGTGTGTGTGGTAGGAGTGGGG - Intergenic
1126100710 15:45116759-45116781 GTGTGTGTGTGCCAGGAGCTGGG + Intronic
1126881734 15:53106197-53106219 GTCTGTGAGAGGCAGCTGTTGGG + Intergenic
1128619115 15:69133818-69133840 GAGTGAGGGTGGCAGGTGATGGG - Intergenic
1128717652 15:69920386-69920408 GTGTGTGAGTGTGTGGTGTGGGG - Intergenic
1129058565 15:72840333-72840355 GGGTGTGAGTGCCAGGGGGTGGG + Intergenic
1129150654 15:73685485-73685507 GTGTGTGTGTGGCGGGTGGGGGG + Intronic
1129154355 15:73708698-73708720 GAGTGTGACTGGAAGGTGGTGGG + Intronic
1129300296 15:74621528-74621550 GGCTGTGAGTGGCAGCTGTCAGG + Intronic
1129648159 15:77457425-77457447 CTGTGTAAGTGGCTGATGTTTGG + Intronic
1131067922 15:89445879-89445901 GTGTGGTGGTGGCAGGGGTTTGG + Intergenic
1131872079 15:96773628-96773650 GTCTGTGAATGGCTGGGGTTGGG - Intergenic
1132640899 16:977810-977832 GTGTGTGTGTGGTGTGTGTTGGG - Intronic
1132644924 16:994357-994379 ATGGGTGAGTGGCTGGTGGTTGG - Intergenic
1132764259 16:1526394-1526416 GTGTGTGCCTGTCAGGTGTGTGG - Intronic
1132766162 16:1535306-1535328 GGGTTTGAGTGGCAGGTGTGAGG + Intronic
1133012630 16:2923044-2923066 GTGTGTGTGTGGCTGTTGTGCGG + Intronic
1134106843 16:11491667-11491689 GTGTGTGTGTGGGAGGGGTGTGG - Intronic
1135974867 16:27101927-27101949 GTGGCTGAGTGTCAGGTGCTTGG - Intergenic
1136078393 16:27833228-27833250 GTGTGGTAGTGGCAGGGGTGGGG - Intronic
1136115094 16:28089388-28089410 GTGTGTGTGTGGTATGTGTGGGG - Intergenic
1136115152 16:28089763-28089785 GTGTGTGGGGGGCATGTGTGTGG - Intergenic
1137635243 16:49980356-49980378 TTGTGTGAGTGTCAGGTCATCGG - Intergenic
1137649215 16:50104706-50104728 GTGACTGAATGGCAGGTGGTAGG - Intronic
1138083942 16:54116689-54116711 GTGTTTGGGAGGCAGGTTTTGGG + Exonic
1138837885 16:60460184-60460206 GTGTGGGAGTAGCAGGTGAGAGG - Intergenic
1138975547 16:62202834-62202856 GTGTCTGGGTGGAAGGGGTTGGG + Intergenic
1139078006 16:63478343-63478365 GTGTGTGTGTGGCAGTGGTGGGG + Intergenic
1139408613 16:66740185-66740207 TTGTGTCTGTGGCAGCTGTTTGG - Intronic
1139798693 16:69503693-69503715 GTTTCTGAGGGTCAGGTGTTTGG - Intergenic
1139827109 16:69766116-69766138 CTGTCTGAGGGGCAGGTGTAGGG - Intronic
1140249981 16:73287327-73287349 GTGTGTGGGTGGTGGGTGTGTGG + Intergenic
1140249997 16:73287382-73287404 GTGTGTGGGTGGTGGGTGTGTGG + Intergenic
1140250012 16:73287437-73287459 GTGTGTGGGTGGTGGGTGTGTGG + Intergenic
1140313658 16:73872853-73872875 GCGGGTGGGTGGCAGGTGGTGGG + Intergenic
1140804610 16:78521378-78521400 GTGTGTGGGTGGGTGGTGATGGG + Intronic
1140949664 16:79804735-79804757 GTGTGTGAGTGTCAATCGTTAGG - Intergenic
1141497020 16:84417230-84417252 GTGAGTGAGAGGCAGGTGTGGGG + Intronic
1141892057 16:86932786-86932808 GTGTGTGAGTGTAAAGTGTGAGG + Intergenic
1142245850 16:88969732-88969754 GGGTGCGAGTGGCAGGTGCCGGG + Intronic
1142449973 16:90168794-90168816 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1142502274 17:339777-339799 CTGGGTGTGTGGCAGGTGCTCGG - Intronic
1142761509 17:2044685-2044707 GTGTGTGTGTGTCAGGGGGTGGG - Intergenic
1143095719 17:4477305-4477327 GCTGGTGCGTGGCAGGTGTTTGG + Intronic
1143595406 17:7910989-7911011 GAGTGTGAGTAGCAGGGGGTAGG - Intronic
1143669702 17:8387982-8388004 GTGTGTGTGTTGCAGGGGTTGGG + Intergenic
1144166956 17:12622073-12622095 GTGGGTGAGAGACAGGTGATAGG - Intergenic
1144646954 17:16981551-16981573 GTGTGTGCACGGCAGGTGTTAGG + Intergenic
1144738461 17:17568010-17568032 GTGTGTGTGTGTCAGAAGTTAGG - Intronic
1144967548 17:19087577-19087599 ATGTGTGTGTGGCAGGGGTGGGG + Intergenic
1144980371 17:19164488-19164510 ATGTGTGTGTGGCAGGGGTGGGG - Intergenic
1144987851 17:19213744-19213766 ATGTGTGTGTGGCAGGGGTGGGG + Intergenic
1145092401 17:19996773-19996795 GTGTGTGAGTGGCAGGATGCAGG - Intergenic
1145374810 17:22337647-22337669 GGCTTTGAGTGGCAGGTGTGTGG + Intergenic
1147262583 17:39217289-39217311 CTGTGTGAGGGGTAGGTGCTGGG - Intronic
1148248408 17:46052139-46052161 GTGGGTGAGTGGGAGGATTTAGG + Intronic
1149496084 17:57118455-57118477 GTGTGTGGTTGGCAGGGGTGGGG + Intronic
1150586619 17:66524103-66524125 GTGTGTGAGTGGGAGGAGATGGG + Intronic
1150636324 17:66915706-66915728 GTGTGTGAGGTGGAGGAGTTAGG - Intergenic
1151215176 17:72572149-72572171 GTGAGTTAGTGGCAGGAGGTGGG - Intergenic
1151566899 17:74903697-74903719 GTGTGTGTGTGGCATGGGTGAGG - Intergenic
1152435782 17:80275070-80275092 GTGTGTGAGTGGGGTGTGTTGGG + Intronic
1152436787 17:80281218-80281240 GTGTGTGAGTGGGGTGTGTGTGG - Intronic
1152436845 17:80281528-80281550 GTGTGTGAGTGGTATGAGTGGGG - Intronic
1152590220 17:81208119-81208141 GTGTGTGTGTGGTATGTGTGTGG - Intronic
1152695701 17:81793179-81793201 GTGTGTGTGTGGGGGGTGTGTGG - Intergenic
1152797176 17:82314206-82314228 GTGAGTGAGGGGCAGGTGTGAGG + Intergenic
1152919615 17:83059439-83059461 AGGTGTGTGGGGCAGGTGTTGGG - Intergenic
1153538543 18:6130249-6130271 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
1153901524 18:9621547-9621569 GTAGGTATGTGGCAGGTGTTGGG + Intergenic
1153986173 18:10352703-10352725 GTGTGTGCATGGCAGGGGTTGGG + Intergenic
1154045477 18:10900703-10900725 GTGTGTGTGTGGTTGATGTTTGG - Intronic
1156384767 18:36595150-36595172 GTGTTTCAGTGGCAGGAGCTGGG - Intronic
1157105246 18:44768392-44768414 GTGTGTGTGTGGTATGTGTCTGG + Intronic
1157350557 18:46881121-46881143 GTGGGAGACTGGCAGGAGTTGGG - Intronic
1157472749 18:48002735-48002757 GTGTGTGTGTGTCTGGTGTGTGG + Intergenic
1157700995 18:49761570-49761592 GAGTGTGTGTGGGATGTGTTTGG - Intergenic
1157909667 18:51603993-51604015 GTGTGTGTGTGGCAGGGGATGGG + Intergenic
1158560890 18:58512664-58512686 GTGTGTGTGTGGTATGTGTGTGG + Intronic
1159079526 18:63721716-63721738 GTGTGTGTGTGTCGGGTGGTAGG + Intronic
1159387982 18:67751619-67751641 GTGTGTGTGTGGCGGGGGTGTGG + Intergenic
1159760755 18:72422731-72422753 GTCTGTGTGGGGAAGGTGTTTGG - Intergenic
1159948916 18:74464969-74464991 GTGTGTGTGTGGCAAGTGGGGGG + Intergenic
1160358506 18:78248996-78249018 GTGTGTGTGTGGTGTGTGTTTGG - Intergenic
1160415050 18:78703941-78703963 GTGTGTGTGTGGTGTGTGTTGGG + Intergenic
1160415087 18:78704204-78704226 GTGTGTGTGTGGTGCGTGTTGGG + Intergenic
1160955726 19:1690951-1690973 GTGTGGGCGTGGCCTGTGTTTGG - Intergenic
1160966047 19:1747406-1747428 GTGTGTGTGTGGCGGGCGGTGGG - Intergenic
1161281391 19:3447645-3447667 GTGTGGGAGTGGCAGCTGTGAGG - Intronic
1161556573 19:4945970-4945992 GTGTGTGTGTGGGAGGGGTGGGG + Intronic
1162145424 19:8610184-8610206 GTGTGTGTGTGTCTGGTGTGGGG - Intronic
1162185923 19:8904755-8904777 GTGTGTTAGGGGCAGATGTGAGG + Intronic
1162744066 19:12789524-12789546 ATGAGTGAGTGGGGGGTGTTGGG + Intronic
1162787423 19:13044406-13044428 GTGTCTGAGTGTCAGGAGGTGGG + Intronic
1163699247 19:18778948-18778970 GTGTTTTAGTGGCAGGTTTCAGG + Exonic
1164044270 19:21521996-21522018 GTGTTTCAGTGGCAGATGGTAGG + Intronic
1164157793 19:22607082-22607104 CTGTGTGAGTGGCAGCGGCTTGG + Intergenic
1164524989 19:29007064-29007086 GTGTGTGTGTGTCTGGTGTGTGG - Intergenic
1164620864 19:29695326-29695348 GTGTCTGGGTGTCAGGTGTCCGG - Intergenic
1164620887 19:29695449-29695471 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164620931 19:29695665-29695687 GTGTCTGGGTGTCAGGTGTCCGG - Intergenic
1164620943 19:29695727-29695749 GTGTCTGGGTGCCAGGTGTCTGG - Intergenic
1164620993 19:29695983-29696005 GTGTCTGGGTGTCAGGTGTCAGG - Intergenic
1164621006 19:29696052-29696074 GTGTCTGGGTGTCAGGTGTCGGG - Intergenic
1164621049 19:29696274-29696296 GTGCCTGAGTGTCAGGTGTCTGG - Intergenic
1164621078 19:29696453-29696475 GTGTCTGGGTGTCAGGTGTCAGG - Intergenic
1164621081 19:29696468-29696490 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164621111 19:29696622-29696644 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164621121 19:29696660-29696682 GTGTCTGGGTGTCAGGTGTCTGG - Intergenic
1164956804 19:32393251-32393273 GGGTATGTGTGGCCGGTGTTGGG - Intergenic
1165323869 19:35102793-35102815 GTGAGTGAGGGGCAGGTGGGAGG - Intergenic
1165354812 19:35297145-35297167 GTGTGTGTGTGGTGTGTGTTTGG - Intronic
1165570677 19:36772417-36772439 GTGCGTGAGTTGCAGGTCTGTGG - Intronic
1166111714 19:40626911-40626933 GTATGTGAGTGGTGGGTGTGGGG + Intronic
1166147486 19:40847608-40847630 GTGTGTGATTGGAAAGGGTTGGG + Intronic
1166151632 19:40879493-40879515 GTGTGTGATTGGAAAGGGTTGGG + Intronic
1166170515 19:41024992-41025014 GTGTGTGATTGGAAAGGGTTGGG + Intergenic
1166178548 19:41091152-41091174 GTGTGTGATTGGAAAGGGTTGGG - Intronic
1166317119 19:41995475-41995497 GTGTATGTGTGGGAGGTGTGTGG - Intronic
1166536193 19:43576465-43576487 GTGTGTGTGTGGTGGGGGTTGGG - Intronic
1166623400 19:44326388-44326410 GTGTGTGAGTGGGAGAAGTATGG + Intergenic
1166729669 19:45052006-45052028 GTGTGTGAGGGGGTGGGGTTTGG + Intronic
1166730938 19:45058774-45058796 GGGTGTGGGTCACAGGTGTTTGG - Intronic
1166768370 19:45265732-45265754 GTGTGAGGGTGCCAGGTGTGTGG + Intronic
1166828164 19:45622087-45622109 GTGGGTAGGTGGCAGGTGCTTGG - Intronic
1167263796 19:48473379-48473401 GTGAGTGAGGGGGAGGGGTTTGG + Intronic
1167406756 19:49314928-49314950 TTGTAGGAGTGGCAGGTGCTTGG - Intronic
1168114056 19:54211123-54211145 GTGTGTGTGTGGCAGGGGGTGGG + Intronic
1168305773 19:55434268-55434290 GTGTGTGTGTGGTGGGTGTGTGG + Intronic
1168459195 19:56539225-56539247 AGGTGAGAGTGACAGGTGTTTGG + Exonic
1202632984 1_KI270706v1_random:17019-17041 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1202652891 1_KI270707v1_random:23031-23053 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1202659260 1_KI270708v1_random:52713-52735 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
925267023 2:2572820-2572842 GTGTGTGTGAGGCATGTGTGTGG - Intergenic
925267046 2:2573136-2573158 GTGTGTGTGAGGCATGTGTGTGG - Intergenic
925329271 2:3045604-3045626 GTGTGTGTGTGCCAAGTGTCTGG + Intergenic
925374942 2:3377705-3377727 GCGTGTGAGTGGCCGGGGTCGGG - Exonic
925454521 2:4003725-4003747 GTGTGTGTGTGGCAGGGGAGGGG - Intergenic
925587169 2:5475473-5475495 GTGTGGGTGTGGGAGGTGTTGGG + Intergenic
925723845 2:6854055-6854077 GTTTGTGAGTAACAGGAGTTGGG - Intronic
925826439 2:7852725-7852747 ATGTGTGAGTGGGAGGGGGTAGG - Intergenic
926087615 2:10029778-10029800 GTGTGTGTGTGGCGGGGGTGGGG - Intergenic
926162170 2:10496694-10496716 GTGGGTGGGTGGCAGGTGGCAGG - Intergenic
926317416 2:11721298-11721320 GTGTGTGTGTGTCAGGGGTGAGG + Intronic
926522786 2:13937252-13937274 GTGTGTGTGTAGTAGGGGTTGGG + Intergenic
926776730 2:16430656-16430678 GTAAGCGAGTGGGAGGTGTTGGG - Intergenic
927228509 2:20795934-20795956 GTGTGTGTGTGGCAGGTTTCGGG - Intronic
927477978 2:23428599-23428621 GTGTGTGTGTGGCGGGGGGTAGG - Intronic
928205315 2:29279506-29279528 GTCTGTGGGTGGTAGGTGATGGG + Intronic
928688383 2:33773684-33773706 GTGTGTGGGTGGCGGGGGGTGGG + Intergenic
928862198 2:35872570-35872592 GTGTGTGTGTGTGTGGTGTTTGG - Intergenic
929595793 2:43174815-43174837 GTGTGTGTGTGTCAGATCTTCGG - Intergenic
930400416 2:50877963-50877985 GTGGATGAGTGGCAGGTGGTTGG - Intronic
930541470 2:52712215-52712237 CTGTGTGAGTGGTAGATGTATGG + Intergenic
930712481 2:54561991-54562013 GTGTGTGTGTGTTGGGTGTTGGG - Intronic
930883227 2:56295579-56295601 GGGTGTGCGTGGCAAGTGCTTGG + Intronic
931146589 2:59526427-59526449 ATGTGGGAGTGGGAGGTGTGTGG - Intergenic
931894683 2:66716080-66716102 CTGTGTGTGTGTCTGGTGTTTGG + Intergenic
932423974 2:71617646-71617668 GTGTGTGTGTGGCAGAGGTGGGG + Intronic
934104991 2:88687325-88687347 GTGTGAGAGTGGAGGGTGTGAGG + Intergenic
934663155 2:96153807-96153829 GTGTGTGTGTGGCAGGTGTGTGG - Intergenic
934916007 2:98301523-98301545 GTGTCTGACAGGTAGGTGTTAGG + Intronic
936267108 2:111018919-111018941 GGCTGTGAGTGGGAGGTGATGGG - Intronic
937078430 2:119123891-119123913 GTGTATGAGTGGCTGGTGCATGG + Intergenic
937126308 2:119476971-119476993 GGGTGTGTGTGGCAGGGGTAGGG + Intronic
937314290 2:120921258-120921280 GTGTGTTGGTGGGGGGTGTTGGG + Intronic
938277294 2:130037885-130037907 GGGGCTGAGGGGCAGGTGTTGGG - Intergenic
938438090 2:131299493-131299515 GGGGCTGAGGGGCAGGTGTTGGG + Intronic
939260779 2:139806100-139806122 GTGTGTGTGTTGCAGGGGTAGGG + Intergenic
939933488 2:148259577-148259599 GTGGGTGAGTGGCAGGTAGCAGG + Intronic
940003859 2:148993902-148993924 GTGTGTGTGTGGCATGTGGTGGG + Intronic
940038717 2:149336949-149336971 GTGTGTGTGTGTTTGGTGTTAGG + Intronic
942208046 2:173642434-173642456 GTGTGTGTGTGGTGTGTGTTTGG + Intergenic
942238903 2:173940784-173940806 GGGTGAGAGGGCCAGGTGTTAGG - Intronic
942837055 2:180313372-180313394 GTGTGTGAGTGTGTGGTGTGGGG - Intergenic
944356355 2:198793181-198793203 GAGTGTGGGTGGCAGGGGATAGG - Intergenic
944482231 2:200169628-200169650 GTGTATTAGTGGTAGGTTTTGGG + Intergenic
945128025 2:206535053-206535075 GTGTGTATGTGGCTGGGGTTAGG + Intronic
945152330 2:206804325-206804347 GTGTGTGTGTGGTGTGTGTTGGG + Intergenic
945712630 2:213317877-213317899 GTGTGGGAGTAGGAGGTGTATGG + Intronic
945888911 2:215407943-215407965 GTGTGTGTGTGGCGGGGGTGGGG - Intronic
946110852 2:217414720-217414742 GGGTCTTAGTGGGAGGTGTTTGG - Intronic
946225162 2:218260673-218260695 TGGTGGCAGTGGCAGGTGTTTGG - Intronic
946466637 2:219917967-219917989 GTGTGTGTGTGTTATGTGTTTGG + Intergenic
946592955 2:221271735-221271757 GTGTGTGCATGGCAGGGGCTGGG - Intergenic
946793706 2:223327610-223327632 GTGTGTGTGTAGCAGGGATTGGG - Intergenic
946826612 2:223685752-223685774 GGGTGTTATTGGCAAGTGTTTGG + Intergenic
947385444 2:229586417-229586439 GTGGGTGGGTGGGGGGTGTTGGG - Intronic
948150545 2:235740948-235740970 TTGTGTGTGTGGCAGGTGGCAGG + Exonic
948367217 2:237464778-237464800 GTGTGTGTGTGGCGTGTGTGTGG + Intergenic
948563635 2:238870113-238870135 GTGTGTGTGTGGGGGGTGTATGG - Intronic
948563708 2:238870465-238870487 GTGTGTGTGTGGCGTGTGTCGGG - Intronic
1168961160 20:1871035-1871057 GAGTGTGAGAGGCAGGGGTGCGG + Intergenic
1169194503 20:3675909-3675931 GTGTGTGTGGGGCAGGGGTAGGG - Intronic
1169198625 20:3696957-3696979 CTGTGTGTGTGGCAGGAGGTGGG - Intronic
1169267527 20:4175712-4175734 GTGTGTGATGGGCAGGTCTTGGG + Intronic
1170857333 20:20069164-20069186 GTGTGTGAGAGACTGCTGTTTGG + Intronic
1171024441 20:21615934-21615956 GTGTGTGTGAAGCATGTGTTTGG - Intergenic
1171216606 20:23356903-23356925 GGGTGGGAGGGGCAGGAGTTGGG + Intergenic
1171275712 20:23855263-23855285 GTGTGGGAGTAGGAGGTGGTTGG + Intergenic
1171527990 20:25830776-25830798 GGCTTTGAGTGGCAGGTGTGCGG - Intronic
1171546993 20:26010176-26010198 GTGCGTGAGTTGCAGGTCTGTGG + Intergenic
1171548836 20:26025104-26025126 GGCTTTGAGTGGCAGGTGTGCGG + Intergenic
1172181518 20:33006696-33006718 GTCTGTGAGTGTGTGGTGTTAGG - Intergenic
1172272253 20:33661284-33661306 GTGTGTGTGTGGTAGGGGTTAGG - Intronic
1173183439 20:40821347-40821369 GGGTGGGAGTGGGAGTTGTTAGG - Intergenic
1173775369 20:45701946-45701968 GGGTGTGATTGGGAGGTGCTTGG + Intronic
1173830718 20:46085431-46085453 GTATGTGTGTGGCAGGTGAAAGG + Intronic
1175415250 20:58796725-58796747 GTGTGGAAGGGGCAGGTGTCTGG - Intergenic
1175520787 20:59601549-59601571 GTGTGTGAAAGGCACCTGTTTGG - Intronic
1175658586 20:60793036-60793058 TTGTTTGAGAGGCAGGTGTCAGG - Intergenic
1175793132 20:61754829-61754851 GTGTGTGTGGGGCATGTGTGTGG - Intronic
1176012555 20:62907042-62907064 GTGTGGGGGTGGCAGGTGTAGGG - Intronic
1176599261 21:8776620-8776642 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1176628795 21:9118445-9118467 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1176645204 21:9342899-9342921 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1178575729 21:33788270-33788292 GTGTGTGTGTGGAAGGAGGTGGG - Intronic
1178599711 21:33985095-33985117 GTGTGTGTGTGGTATGTGTGTGG - Intergenic
1178823276 21:35994227-35994249 GTGTGTGAGTGGGGTGTGTGAGG - Intronic
1179019546 21:37625980-37626002 GTGTGTTAATGGCAGGTGGGAGG - Intronic
1179428659 21:41303875-41303897 GTGTGTGTGTGGCAGGGGGGGGG + Intergenic
1179438154 21:41376064-41376086 GTGTGGGAGAAGCAGGTGTTGGG - Intronic
1179532180 21:42027375-42027397 GTGTATGTGTGGCATGTGTGTGG + Intergenic
1179532196 21:42027499-42027521 GTGTGTGTGTGGCATCTGTGTGG + Intergenic
1179769597 21:43604731-43604753 GTGTGTGAGTGGTGTGTGTGTGG - Intronic
1179824957 21:43958910-43958932 GTGTGTGTGTGGCATGTGTGTGG + Intronic
1179824964 21:43958993-43959015 GTGTGTGTGTAGCATGTGTGTGG + Intronic
1179824973 21:43959084-43959106 GTGTGTGTGTGTCATGTGTGTGG + Intronic
1179824975 21:43959115-43959137 GTGTGTGTGTGGCATGTGTTTGG + Intronic
1179824999 21:43959327-43959349 GTGTGTGTGTGGCGTGTGTGTGG + Intronic
1179825013 21:43959476-43959498 GTATGTGTGTGGCACGTGTGTGG + Intronic
1180326722 22:11436238-11436260 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1180367747 22:11956335-11956357 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1180378344 22:12114999-12115021 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1180419167 22:12798280-12798302 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1180986826 22:19909783-19909805 GTGTGTGAGTGGTGTGTGTGTGG - Intronic
1180986835 22:19909859-19909881 GTGTGTGAGTGGTGTGTGTGTGG - Intronic
1181266467 22:21633755-21633777 GTGTGTGAAATGTAGGTGTTAGG + Intronic
1181729693 22:24835735-24835757 GTGTGTGTAGAGCAGGTGTTGGG + Intronic
1182561149 22:31160304-31160326 GTATGTGAGGGGCTGGGGTTGGG + Intronic
1182885199 22:33767903-33767925 ATGTGTGAGTGGCAGGATTCAGG - Intronic
1182980724 22:34668365-34668387 GTGGTTAAGTGGGAGGTGTTTGG - Intergenic
1183751448 22:39723311-39723333 GTGTGTGTGTGTCAGGTGGGTGG - Intergenic
1184208739 22:43022940-43022962 GTGTGTGTGTGGCAGGGGCGTGG - Intergenic
1184268683 22:43364875-43364897 GTGTATGAGAGCCAGCTGTTGGG + Intergenic
1184523037 22:45007229-45007251 GTGCGCGAGTGGCGGGTTTTGGG - Intronic
1184777084 22:46628635-46628657 GTGTCTGAGGGGCAGGTGGAGGG + Intronic
1185068019 22:48641635-48641657 GTGTGTGAGGGGAGGGTGTGCGG - Intronic
1185077314 22:48690335-48690357 GGGTGTGATAGGCAGGTGTGAGG + Intronic
949331848 3:2932041-2932063 GTGTGTGTGTGGCCGGGGTGGGG + Intronic
949525078 3:4895372-4895394 GTGTGTGAGTGGTTGTTTTTAGG - Intergenic
949559847 3:5190782-5190804 GTTTGTAAGTGGCAAGTGTGAGG - Intronic
950549968 3:13660280-13660302 CTGTGAAAGGGGCAGGTGTTGGG + Intergenic
950697705 3:14716312-14716334 GTGAGAGAGGGGCAAGTGTTGGG + Intronic
950711452 3:14815876-14815898 GAGGGTGAGTGGCTGGTGTGGGG - Intergenic
951432359 3:22622904-22622926 GTTTGGGGGTGGCAGGTGTGTGG - Intergenic
951924226 3:27889342-27889364 GTGGCTGGATGGCAGGTGTTAGG - Intergenic
952193813 3:31051441-31051463 GGTTGTGAGTCACAGGTGTTAGG + Intergenic
952211990 3:31237262-31237284 GTGTGTGTGTGTCAGGGGATGGG - Intergenic
952428733 3:33201629-33201651 GTGTGTGGGTGGCAGGTGAGGGG + Intronic
952562764 3:34614521-34614543 GTGTGTGTGTGTGTGGTGTTTGG - Intergenic
953409792 3:42684307-42684329 GTGTGTGTGTGTCTGGTGGTGGG + Intergenic
954455829 3:50599384-50599406 GTGGGTGGGTGGCAGCTGTGAGG - Intergenic
954554902 3:51509989-51510011 GTGTGTGTGTGGGATGTGTATGG - Intergenic
954633640 3:52059842-52059864 GTGTGGTAGTGGATGGTGTTGGG - Intergenic
955621196 3:60866081-60866103 GTGTATTTGTGGCAGGAGTTTGG - Intronic
956322374 3:68011119-68011141 GTGTGTGTGTGGGGGGTGGTGGG + Intronic
957095114 3:75771145-75771167 GTGTGTGAGTGGCAGAAGTTTGG - Intronic
957198958 3:77107322-77107344 TTGTAAGAGAGGCAGGTGTTTGG + Intronic
958734089 3:97989343-97989365 GTGGGTGAGTGGGTGGTGTGTGG + Intronic
959424538 3:106169880-106169902 GTGTATGAATGGCAAGTTTTAGG + Intergenic
960467271 3:118012801-118012823 GTATTTGAGAGGCAGGTCTTTGG - Intergenic
961089414 3:124097037-124097059 GTGTCTGATTTCCAGGTGTTTGG + Intronic
961723472 3:128910810-128910832 AAGTGTGAGTGGCATGTCTTGGG + Exonic
962149940 3:132881887-132881909 GTGTGTGTGTGGTATGTGTGTGG + Intergenic
962868833 3:139470613-139470635 GTGTGTGAGCCGGAGGGGTTGGG - Intronic
964920257 3:161887426-161887448 GTGTGTGTGTGGCAAGTATATGG - Intergenic
966828646 3:183987240-183987262 GTGACTGTGTGGCAAGTGTTGGG - Intronic
966892071 3:184414576-184414598 GTGTATGTGTGGCATGTGTGTGG + Intronic
966892088 3:184414818-184414840 GTGTGTGTGTGGCGTGTGTGTGG + Intronic
966902995 3:184500502-184500524 GTGTGTGGGAGGCAGGGGTGGGG - Intronic
967693153 3:192500438-192500460 GTGTGTGTGTGGCGGGTGGGGGG - Intronic
967794432 3:193584001-193584023 GTGTGTGAGTGTGATGGGTTGGG - Intronic
967887749 3:194344929-194344951 GTGTGTGTGTGGTGTGTGTTGGG - Intronic
1202741686 3_GL000221v1_random:62169-62191 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
968868598 4:3229092-3229114 GTGTGCAAGTGGCATGTGTGTGG - Intronic
968868637 4:3229529-3229551 ATGTGTGTGTGGCATGTGTGTGG - Intronic
968891032 4:3368630-3368652 GTGTGTGTGTGGTACGTGTGTGG + Intronic
968897808 4:3414927-3414949 GTGTGTGAGGGGCATGTGAGGGG + Intronic
968950288 4:3687913-3687935 GTGGGAGACTGGCAGGAGTTGGG + Intergenic
969298863 4:6285521-6285543 GTGTGGGTGAGGCATGTGTTTGG - Intronic
969426695 4:7128574-7128596 GTGTGTGTGTGTCAGGGGGTGGG + Intergenic
969687942 4:8686978-8687000 GTGTGTGTGTGGTATGTGTGTGG + Intergenic
969687944 4:8687009-8687031 GTGTGTGTGTGGTATGTGTGTGG + Intergenic
969852037 4:9965204-9965226 GTGTGTGTGTGAGAGGTGTGGGG + Intronic
970346984 4:15161924-15161946 TTGTGTGTGTGGCAGGGGGTGGG + Intergenic
971077492 4:23166799-23166821 GTGTGTGTGTGTTATGTGTTAGG - Intergenic
972406845 4:38754520-38754542 GTGTGTGTGTGGATGTTGTTTGG - Intergenic
973259720 4:48150459-48150481 GTGTGTGTGTGGCGGGTTTGGGG - Intronic
973362624 4:49178993-49179015 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
973398479 4:49617860-49617882 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
974078500 4:57189714-57189736 GTGTGTGTGTGGCAGTCATTAGG - Intergenic
974562512 4:63540594-63540616 GTGTCTGAGTGGCAGAAGTGAGG + Intergenic
975408931 4:74025109-74025131 GTGTGTGTGTGGAGGGTGTGGGG + Intergenic
976035218 4:80810341-80810363 GTGTGTGTGTGTCAGGGGTTGGG - Intronic
976679420 4:87738776-87738798 GTGTGTGTGTGTTGGGTGTTGGG + Intergenic
977822517 4:101490818-101490840 GTGTGTGTGTGGTGGGGGTTGGG + Intronic
978430526 4:108628162-108628184 CTTTGGGATTGGCAGGTGTTTGG - Intronic
979380898 4:120005593-120005615 GTGGCTAAGTGGGAGGTGTTTGG + Intergenic
980216974 4:129864959-129864981 TTGTGTGAGTGGGAAGTGTGTGG + Intergenic
980304136 4:131034680-131034702 GTGTGTGTGTGGCCGGGGGTGGG + Intergenic
980343750 4:131584581-131584603 GTGGGTGAGTGGCAGGTAGCTGG + Intergenic
981007075 4:139886155-139886177 GAGTGTGGGAGGCAGGTTTTAGG + Intronic
981121488 4:141056454-141056476 GGGTGTGAGGGGCAGGGGTGTGG + Intronic
983313889 4:166101397-166101419 GTATGTGTGTGTCTGGTGTTTGG + Exonic
983398577 4:167234335-167234357 GTGTGTGAGTGCCCGGCTTTTGG - Intronic
983851978 4:172592380-172592402 GTGGGAGAGTGGGAGATGTTTGG - Intronic
984303246 4:177951622-177951644 GTGTGTGAGTGGCAGGTGTTGGG - Intronic
985070215 4:186160078-186160100 GTGTGTATGTGGTATGTGTTTGG - Intronic
985070219 4:186160129-186160151 GTGTGTATGTGGTATGTGTTTGG - Intronic
985070222 4:186160175-186160197 GTGTGTATGTGGTATGTGTTTGG - Intronic
985140047 4:186830701-186830723 CTGTGTGAGAAGCAGGTTTTGGG - Intergenic
985292172 4:188397702-188397724 GTGTGTGAGTGGCTGAAGTATGG - Intergenic
985330633 4:188828624-188828646 GTGTGTGTGTGTGAGGGGTTGGG + Intergenic
985421689 4:189790954-189790976 GTGAGTGTGTGGCAGCTGATGGG - Intergenic
1202759964 4_GL000008v2_random:100465-100487 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
985519425 5:366064-366086 GTGTGTGTGGGGCAGGGGGTGGG - Intronic
985791354 5:1929659-1929681 TGGTGTGTGTGGCATGTGTTTGG + Intergenic
985870727 5:2553972-2553994 GTGTGTGTGTAGCAGGGGTGTGG - Intergenic
986297335 5:6449864-6449886 GTGTGTGTGTGGGGGGGGTTGGG - Intronic
986483026 5:8208277-8208299 GAATGTGTGTGGCATGTGTTCGG + Intergenic
986799075 5:11241064-11241086 GTGTGTGTGTGTTGGGTGTTAGG - Intronic
987429183 5:17811135-17811157 GTGTGTTTGAGGCAAGTGTTAGG - Intergenic
987536529 5:19196396-19196418 GTGTGTGAGTGGGAGGAGGCGGG + Intergenic
988482422 5:31640851-31640873 GTGTGTGTGTTGCGGGGGTTAGG + Intronic
988527924 5:32002579-32002601 GTGTGTGTGTGGTATGTGTGAGG - Intronic
989411719 5:41127045-41127067 GTGTTTGGGAGGCAGGTGATGGG - Intergenic
992101587 5:73412913-73412935 GAGTATGAATGGCAGGAGTTTGG - Intergenic
992209951 5:74469104-74469126 GTGTGTGTGAGACAGGAGTTTGG - Intergenic
992424972 5:76647816-76647838 GTGTGTGTGTGTGTGGTGTTTGG - Intronic
992757902 5:79926210-79926232 GGGTGTGAGGGGCAGAGGTTAGG + Intergenic
993492553 5:88569779-88569801 GTGTGGGAGTGGCAGGAATGTGG - Intergenic
993968854 5:94391837-94391859 TTATGTGAGTGGCAGCGGTTTGG - Intronic
994728440 5:103463804-103463826 ATGTGGGAGTGGCAGGTTTCAGG + Intergenic
994788176 5:104189430-104189452 GTGGGTGAGTGGCAGGTAGCTGG - Intergenic
995122373 5:108549829-108549851 GGGAGTGAGTGGAAGGTGGTGGG + Intergenic
995127235 5:108590443-108590465 GTATGTGTGTGGCAGGGGTGGGG + Intergenic
996328196 5:122299999-122300021 GTGTGTGTCTGGCATGTGTGTGG + Intergenic
997602944 5:135152693-135152715 GTGTGTTGGTGGAAGGAGTTGGG + Intronic
998059360 5:139107192-139107214 GTGCTTAAGAGGCAGGTGTTGGG + Intronic
998210074 5:140189183-140189205 GTGGGTTGGTGGGAGGTGTTTGG + Intronic
998273879 5:140733242-140733264 GTGTGTGTGTGTTTGGTGTTTGG - Intergenic
998867822 5:146522804-146522826 GTTTGTGAGAGCCAGGTGCTGGG + Intergenic
999178921 5:149654885-149654907 GTGTGTGTGTGTGAGGTGTGTGG - Intergenic
999242580 5:150136394-150136416 GTGTGTGTGTGTCAAGTGATTGG + Intronic
1000872860 5:166599098-166599120 GAAAGTGAATGGCAGGTGTTAGG - Intergenic
1001492850 5:172168012-172168034 CTGGCTGAGTGGCAGGTGTGAGG + Intronic
1001503379 5:172256283-172256305 GTGTGTTGGGGGCAGGTGTTGGG - Intronic
1002041200 5:176515644-176515666 GTATGTGTGTTGCAGGGGTTGGG + Intergenic
1002321344 5:178377819-178377841 CTGTGTGTGTGGCAGGAGCTGGG + Intronic
1002845673 6:942380-942402 GGGGCTTAGTGGCAGGTGTTTGG - Intergenic
1002859532 6:1068143-1068165 GTGTGTGTGTGGTATGTGTGTGG + Intergenic
1003179084 6:3776853-3776875 GTGTGTGTGTTGGATGTGTTGGG + Intergenic
1004179096 6:13365461-13365483 GTGTGTGAGGTGCAGGTGCACGG - Exonic
1004961473 6:20794545-20794567 GTGTGTGGGTAGTAGGTATTTGG - Intronic
1005317935 6:24622160-24622182 GTGCATGAGTGGGAGGTGTCTGG - Intronic
1005824973 6:29627346-29627368 TTGTGTGACTGGCAGGAGATGGG - Intronic
1006079862 6:31558922-31558944 GCGTGTGTGTTGCAGGTGTGTGG - Intergenic
1006444633 6:34073227-34073249 GTGTGTGTGTGGCATGTATTTGG - Intronic
1007406580 6:41639067-41639089 GTGTGTGTGTGTCTGGTGTCGGG - Intronic
1007783034 6:44265044-44265066 GTGGGGGAGTGGCAGGCGTGGGG + Exonic
1008173754 6:48240887-48240909 GTGTGTGTGTGTGTGGTGTTTGG + Intergenic
1008370314 6:50723826-50723848 GTGTGTGTATGGCGGGGGTTGGG - Intronic
1009659650 6:66594268-66594290 GTGTGTGAGAGAGAGGGGTTGGG - Intergenic
1009712696 6:67346324-67346346 GTGGGTGAGTGGCAGGTAGGTGG - Intergenic
1010717231 6:79243701-79243723 ATGTGTGAGTGGGAGGTGGGAGG + Intergenic
1011957708 6:93043929-93043951 GTGTGTGACATGCTGGTGTTGGG - Intergenic
1013244663 6:108275080-108275102 GTGTGTGTGTGGCAGGGGGTGGG + Intergenic
1013564260 6:111341737-111341759 CTGTGCAAGTGGCAGGAGTTGGG + Intronic
1014645056 6:123962911-123962933 GTGGGTGAGTGGCAGGTGGCTGG - Intronic
1015012943 6:128374457-128374479 ATGTGAGAGGGGCAGATGTTTGG - Intronic
1015413894 6:132926736-132926758 GTGTGTGAGCGGGAGGGGTAGGG - Intergenic
1015847146 6:137532497-137532519 GTGTGTGTGTGGCGGGGGTAGGG + Intergenic
1016870621 6:148812837-148812859 GGGTGTGAATGGCAGGAGGTGGG + Intronic
1017048952 6:150372561-150372583 GTGTGTGTGTGGGCGGTGTGGGG + Intronic
1017619877 6:156285746-156285768 GTGTGTGTGTGGCAGGGATGGGG + Intergenic
1017662844 6:156690754-156690776 GTGTGTGAATGACAGTTGTGTGG + Intergenic
1017902226 6:158728257-158728279 GTGTGTGAGTGAATGGTGTAAGG + Intronic
1018134314 6:160764934-160764956 GTGTGTGTGTGGTATGTGTATGG + Intergenic
1018268166 6:162048345-162048367 CTGTGTGACTGTCAGGTGTGAGG + Intronic
1018771012 6:166971462-166971484 GTGGGTGTGTGGCAGGTGTCCGG - Intergenic
1018793896 6:167171421-167171443 GGGTGTGAGTGGGATGTGTGTGG - Intronic
1018822439 6:167383670-167383692 GGGTGTGAGTGGGATGTGTGTGG + Intronic
1018927372 6:168215608-168215630 GTGCGACAGTGGCAGGTGGTTGG - Intergenic
1019910826 7:4099753-4099775 GTGTGTGAGCGGGATGTGATGGG + Intronic
1019944557 7:4316319-4316341 CTGAGTGAGTAGCAGGTGGTGGG - Intergenic
1020806340 7:12794847-12794869 GTGTGTGAGTTGTATGTGTGGGG - Intergenic
1020865508 7:13556238-13556260 GTGAGTGAGGGTCATGTGTTTGG - Intergenic
1021014113 7:15511193-15511215 GTGTGTGAGTGCCCTGTGATAGG - Intronic
1021075767 7:16302690-16302712 CTAGGTGAGTGCCAGGTGTTGGG + Intronic
1021857602 7:24872473-24872495 GTGTGTGTGTGTGTGGTGTTGGG + Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022563714 7:31375535-31375557 GTGTGTAAATGGACGGTGTTTGG - Intergenic
1023256155 7:38314571-38314593 GTGTGTGAGTCAAAGGTCTTAGG + Intergenic
1023689048 7:42767152-42767174 GCGTGTGAGTGGTATGTGTGGGG - Intergenic
1023826760 7:44014953-44014975 GTGTGTGTGTGGCGGGGGTAGGG - Intergenic
1024074974 7:45813609-45813631 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1024074986 7:45813658-45813680 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1024074998 7:45813707-45813729 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1024221927 7:47295702-47295724 GTGTGAGAGTGGAAGGGGTGGGG - Intronic
1024230418 7:47359364-47359386 ATGAGTGAGTGCCAGGGGTTTGG + Intronic
1024324957 7:48102222-48102244 GTGTGAGGGTGGCAGGTGCAGGG + Intronic
1025008208 7:55371917-55371939 GTGTGTGTGTGTCAGGTGGAAGG + Intronic
1025129481 7:56368074-56368096 GCGTGGGAGCGGCAGGTGTGAGG + Intergenic
1025129791 7:56369303-56369325 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025130098 7:56370556-56370578 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025130418 7:56371854-56371876 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025130739 7:56373152-56373174 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1025131053 7:56374445-56374467 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1026067791 7:67090710-67090732 GTGTGTGAGTGTCAGATAATGGG + Intronic
1027255280 7:76426867-76426889 GTGTGTGTGTGTGTGGTGTTTGG - Intronic
1027308632 7:76929452-76929474 GTTTGTGGGTGGTAGGTGGTGGG - Intergenic
1027504831 7:79003184-79003206 GTGTGTATGTAGCAGGTGGTGGG + Intronic
1027943483 7:84715518-84715540 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1028820469 7:95205006-95205028 GTGTGTGTGTGGCGTGTGTGTGG - Intronic
1029087602 7:98023436-98023458 GTGTGTGTGTGGCGGGGGTTGGG + Intergenic
1029408827 7:100395713-100395735 GTGTGTAAATGACAAGTGTTGGG + Intronic
1030375711 7:108751059-108751081 GTGTGTGTGTTGGGGGTGTTGGG - Intergenic
1031034772 7:116776627-116776649 GTATGTGAGTGTCAGGCATTAGG - Intronic
1031198410 7:118646262-118646284 GTGTGTGAGTGGTTGATGTATGG + Intergenic
1031397193 7:121287248-121287270 GTGTCTGTGTGGCAGGAGGTTGG - Intronic
1032500620 7:132396998-132397020 CTGTCAGAGTGGCAGGTGTCTGG - Intronic
1032534986 7:132655661-132655683 CTGGGTGAGTTGCTGGTGTTGGG - Intronic
1032789497 7:135232100-135232122 TTGTGTGTGTGGCAGTGGTTGGG + Intronic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033244015 7:139703776-139703798 GTGTGTGTGTGGTGTGTGTTGGG - Intronic
1033244081 7:139704109-139704131 GTGTGTGTGTGGTGTGTGTTGGG - Intronic
1033244148 7:139704447-139704469 GTGTGTGTGTGGTATGTGTTGGG - Intronic
1033281492 7:140009620-140009642 GTGGGTGTGGGGCAGGTGTGGGG - Intronic
1033454795 7:141492973-141492995 GTGTGTGTGTTGCAGTTGTAGGG + Intergenic
1033560808 7:142528728-142528750 GGGTAGGAGTGGGAGGTGTTTGG - Intergenic
1033588186 7:142789678-142789700 GCCTGTGTTTGGCAGGTGTTTGG + Intergenic
1033600813 7:142887201-142887223 GTGTGTGTGTGGCGTGTGTATGG + Intergenic
1033773482 7:144580439-144580461 GTGGGTGAGAGGCAGGTATCAGG + Intronic
1033773746 7:144583087-144583109 ATGGGTGAGTGGCAGGTATTAGG + Intronic
1034384442 7:150727576-150727598 GTGTGTGTGTGGGAGGTTGTTGG - Intronic
1034495132 7:151416319-151416341 GTGAGGGAGTGGGAGGTGTGGGG - Intergenic
1034535851 7:151725218-151725240 GTGTGTGGGTGGCGGGTGGCAGG - Intronic
1034570892 7:151955556-151955578 GTCTGTGAGTGGAAGGGGGTGGG - Intergenic
1035704757 8:1667061-1667083 GTGTGTGTGTGGCAGGGGTGGGG + Intronic
1036195973 8:6715226-6715248 GTGGGTGAGAGGTAGGGGTTTGG + Intronic
1036273169 8:7325883-7325905 GTGTGTGTGTGGCGGGGGGTGGG - Intergenic
1036877401 8:12484794-12484816 ATGTATGTGTGGCAGGTGTGAGG + Intergenic
1037110547 8:15159748-15159770 GTGTGTGTGTGGCGGGGGTGGGG - Intronic
1037570505 8:20153931-20153953 GGGGCTGAGTGGGAGGTGTTTGG + Intronic
1038403844 8:27307335-27307357 GTGTGTGTGTGGCGGGGGTGTGG - Intronic
1038559834 8:28564399-28564421 TTGTATGAGAGGAAGGTGTTAGG - Exonic
1038581435 8:28752276-28752298 GGGTGTGAGTGGCATTTGTCAGG + Exonic
1039444810 8:37622512-37622534 GTGTTTGAGTGCAGGGTGTTGGG - Intergenic
1039533093 8:38282324-38282346 GTGAGTGACTGCCAGGGGTTAGG - Intronic
1039913729 8:41844510-41844532 GTGTGTGTGTGGGGGGTGTGTGG - Intronic
1040467462 8:47708425-47708447 GTGTGGGAGTAGAAGGTGTATGG - Intronic
1040617080 8:49047633-49047655 ATGGTTGAGTGGCAGGTGTACGG + Intergenic
1040887038 8:52276117-52276139 GTGTGTGTGTGGTATGTGATAGG - Intronic
1041040287 8:53839878-53839900 GTGTGTGGTTGGAAGGAGTTTGG - Intronic
1041938628 8:63362257-63362279 GTGTGTGTGTGTGTGGTGTTTGG - Intergenic
1042077335 8:65010455-65010477 GTGTGTGGGTGGCAGGGAGTAGG - Intergenic
1042404518 8:68388549-68388571 GTGTGTGAGTTGAAGGGGTGGGG - Intronic
1042886848 8:73561931-73561953 GCCAGTAAGTGGCAGGTGTTGGG + Intronic
1044469714 8:92552517-92552539 GTGTGTGTGGGGGGGGTGTTGGG - Intergenic
1044867202 8:96583402-96583424 GTGTGTGTGTGTCTTGTGTTTGG + Intronic
1045469155 8:102495992-102496014 GTGTGTGTGTGGAGGGTGTGGGG - Intergenic
1045788055 8:105946887-105946909 GTGTGTGTGTGGCGGGGGGTTGG - Intergenic
1047362247 8:124179724-124179746 GTGTGTGTGTGTGTGGTGTTTGG + Intergenic
1047523590 8:125614514-125614536 GTGTGTGAGGGTCAGGTGTGAGG + Intergenic
1047523597 8:125614554-125614576 GTGTGTAAGGGTCAGGTGTGAGG + Intergenic
1047782506 8:128121611-128121633 GTGTGTGTGTAGTAGGTGTATGG - Intergenic
1048223168 8:132561955-132561977 GTGTGCAAGTGGGGGGTGTTGGG - Intergenic
1048292967 8:133194443-133194465 GTGTGTGTGTGGTATGTGTGTGG + Intronic
1048882505 8:138882456-138882478 GTGTATGAGTGTGAGGTGTAGGG - Intronic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1049969498 9:809103-809125 GTGTGTGTGTGGTATGTGTGTGG + Intergenic
1050288972 9:4133813-4133835 GTGTGTGTGTAGAAGGTCTTGGG - Intronic
1051094991 9:13456411-13456433 GTGTGTGTGTGACAGATGTGTGG - Intergenic
1051337336 9:16077670-16077692 ATCTGTGAGTGGGAGGGGTTTGG - Intergenic
1051510044 9:17867780-17867802 GTGTGTGTGTGTCTGGTGTTAGG + Intergenic
1052078249 9:24171938-24171960 GTGTGTGTGTGGCAGGGGGAGGG + Intergenic
1052336706 9:27327589-27327611 GTGTCTGAGTGGTGGGTGGTGGG - Exonic
1053070635 9:35099643-35099665 GTGTGTTTGAGGCAGGTGTTTGG - Intergenic
1053099072 9:35354174-35354196 GGGAGTGAGAGGCAGGAGTTGGG + Intronic
1054147375 9:61572955-61572977 GTGCGTGAGTTGCAGGTCTGTGG + Intergenic
1056222855 9:84467316-84467338 GTGTGTGTGTGGGGGGTGTGTGG + Intergenic
1056222865 9:84467420-84467442 GTGTGTGTGTGGCGTGTGTGTGG + Intergenic
1056222869 9:84467473-84467495 GTGTGTTTGTGGCATGTGTGTGG + Intergenic
1056470941 9:86903931-86903953 GTGTGTGTGTGGCAGGGGGTGGG - Intergenic
1056740886 9:89254646-89254668 GTGTGAGTGTGGCATGTGTGGGG + Intergenic
1056935571 9:90912951-90912973 GTGTGGAAGTGGGGGGTGTTGGG + Intergenic
1057413614 9:94841577-94841599 TTGTTTGAGTTGCAGTTGTTGGG + Intronic
1057631162 9:96720013-96720035 GCGTGTCAGGGGCAGGTGCTTGG + Intergenic
1057685390 9:97229590-97229612 GTGTGTGAGTGAGAGGGGTGAGG + Intergenic
1057805891 9:98219835-98219857 GGTTGTGAGTGGCAGGGTTTGGG + Intronic
1058142884 9:101376655-101376677 GTGCGTGAGTGGGAGGTGGCAGG - Intronic
1058636344 9:107042092-107042114 GGGACTGAGTGGGAGGTGTTTGG + Intergenic
1058878050 9:109261109-109261131 GTGGGTGAGTGGCCGGAGTGCGG + Intronic
1059505424 9:114794876-114794898 GTGTGTGAGTGGGAGAGGATGGG + Intronic
1060972255 9:127744943-127744965 GTGTGGGAGGGGCTGGTGTGGGG + Exonic
1061396214 9:130344903-130344925 GTGTGTGTGTGTGTGGTGTTTGG + Intronic
1061442206 9:130613274-130613296 GTCCTAGAGTGGCAGGTGTTTGG - Intronic
1062119511 9:134826747-134826769 GGGTGTGTGTGGCTGGTGTGTGG + Intronic
1062119523 9:134826812-134826834 GTGGGTGTGTGGCTGGTGTGTGG + Intronic
1203691752 Un_GL000214v1:48680-48702 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1203751641 Un_GL000218v1:86126-86148 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1203710318 Un_KI270742v1:92093-92115 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1203540737 Un_KI270743v1:85359-85381 GTGTGTGAGTGGCAGAAGTTTGG + Intergenic
1203644543 Un_KI270751v1:55511-55533 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1186112089 X:6269200-6269222 GTGTGTGAGGGGAAGGTGAGCGG - Intergenic
1186808232 X:13161482-13161504 GTGTGTGTGTGGCGGGTGGGGGG + Intergenic
1186846025 X:13532050-13532072 GTGGCCTAGTGGCAGGTGTTTGG - Intergenic
1186973455 X:14873830-14873852 GTGTATTTGTGGGAGGTGTTAGG + Intronic
1187547755 X:20268534-20268556 GCCTGCGAGAGGCAGGTGTTGGG + Intergenic
1187640339 X:21281201-21281223 GTGTGTGTCTGTCAGGTTTTGGG + Intergenic
1187659808 X:21530873-21530895 GTGTGTGAGTAATAGGTTTTAGG + Intronic
1188574636 X:31632117-31632139 GTGTGTGTGTGGCGGGAGTAGGG - Intronic
1189202599 X:39210351-39210373 GTGTGTTTGTGGAAGGTGGTGGG + Intergenic
1190266638 X:48831060-48831082 CTGTGTGAGTGGCAGTTTCTAGG - Intergenic
1190930514 X:54945732-54945754 GTGTGTGTGTGTGAGGTGTGTGG + Intronic
1192151053 X:68712635-68712657 GTGGGAGAGTGGGAGGGGTTTGG + Intronic
1192842590 X:74872436-74872458 GTGTGTGGGTGGGGGGTGGTGGG + Intronic
1195405564 X:104509209-104509231 GTGTGTGTGTGGGAGGGGGTTGG + Intergenic
1196271223 X:113713613-113713635 GTGTGTGTGTGGCAGGGTTCGGG + Intergenic
1196765419 X:119237409-119237431 GTATGTGTGTGGCATGTGTTTGG + Intronic
1198024872 X:132695015-132695037 GTGTGAGAGTTGCAGGAGTCTGG + Intronic
1198167970 X:134076240-134076262 GTGTGTGACTGACAGGTGACTGG + Intergenic
1198457191 X:136828389-136828411 GGGTGGGGGTGGGAGGTGTTTGG - Intergenic
1199036641 X:143058400-143058422 GTGTGTGTGTGGGTGGTGGTGGG + Intergenic
1199990815 X:152986938-152986960 GTGTGTGAGTGGGAGGGTGTGGG - Intergenic
1200033904 X:153316412-153316434 GTGTGTGAGTGGGAGGGTGTGGG - Intergenic
1201165297 Y:11203746-11203768 GTGTGTGAGTGGCAGAAGTTTGG - Intergenic
1202380847 Y:24275952-24275974 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1202380858 Y:24276000-24276022 GTGTGGGAGGGGCCGGTGTGAGG - Intergenic
1202489926 Y:25394125-25394147 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic
1202489937 Y:25394173-25394195 GTGTGGGAGGGGCCGGTGTGAGG + Intergenic