ID: 984308457

View in Genome Browser
Species Human (GRCh38)
Location 4:178025247-178025269
Sequence TTGGATACTCACATCCATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984308452_984308457 10 Left 984308452 4:178025214-178025236 CCATATGTCTGGTGTCTTATCAG No data
Right 984308457 4:178025247-178025269 TTGGATACTCACATCCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984308457 Original CRISPR TTGGATACTCACATCCATAA AGG Intergenic
No off target data available for this crispr