ID: 984310287

View in Genome Browser
Species Human (GRCh38)
Location 4:178049578-178049600
Sequence TTGGGATTATAGCACTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984310287_984310292 -7 Left 984310287 4:178049578-178049600 CCTCCCAAGTGCTATAATCCCAA No data
Right 984310292 4:178049594-178049616 ATCCCAAGTGCCGGGATTACAGG No data
984310287_984310296 9 Left 984310287 4:178049578-178049600 CCTCCCAAGTGCTATAATCCCAA No data
Right 984310296 4:178049610-178049632 TTACAGGTGTCAGCCGTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984310287 Original CRISPR TTGGGATTATAGCACTTGGG AGG (reversed) Intergenic
No off target data available for this crispr