ID: 984310383

View in Genome Browser
Species Human (GRCh38)
Location 4:178051003-178051025
Sequence TGGTGTAAGGGGATGGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984310383_984310393 -10 Left 984310383 4:178051003-178051025 CCCTCCCCCATCCCCTTACACCA No data
Right 984310393 4:178051016-178051038 CCTTACACCACAACAGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984310383 Original CRISPR TGGTGTAAGGGGATGGGGGA GGG (reversed) Intergenic
No off target data available for this crispr