ID: 984320794

View in Genome Browser
Species Human (GRCh38)
Location 4:178193201-178193223
Sequence AGTTGATGGTTGGAGTACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984320787_984320794 23 Left 984320787 4:178193155-178193177 CCAGATGTGTTACAGAGTTTGAT No data
Right 984320794 4:178193201-178193223 AGTTGATGGTTGGAGTACGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984320794 Original CRISPR AGTTGATGGTTGGAGTACGG TGG Intergenic
No off target data available for this crispr