ID: 984321403

View in Genome Browser
Species Human (GRCh38)
Location 4:178201685-178201707
Sequence TACCCAGCAAAATGCTGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984321400_984321403 21 Left 984321400 4:178201641-178201663 CCTCTGCTTTTTCACCTCATACT No data
Right 984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG No data
984321399_984321403 29 Left 984321399 4:178201633-178201655 CCTTATGACCTCTGCTTTTTCAC No data
Right 984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG No data
984321401_984321403 7 Left 984321401 4:178201655-178201677 CCTCATACTGAAGAAGCAAAAGA No data
Right 984321403 4:178201685-178201707 TACCCAGCAAAATGCTGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984321403 Original CRISPR TACCCAGCAAAATGCTGAAA GGG Intergenic
No off target data available for this crispr