ID: 984334867

View in Genome Browser
Species Human (GRCh38)
Location 4:178378032-178378054
Sequence GGATGAACACCCTTGGAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984334867_984334871 18 Left 984334867 4:178378032-178378054 CCAGGTTCCAAGGGTGTTCATCC No data
Right 984334871 4:178378073-178378095 CCTACAGTCAGAACAATGTCAGG No data
984334867_984334872 19 Left 984334867 4:178378032-178378054 CCAGGTTCCAAGGGTGTTCATCC No data
Right 984334872 4:178378074-178378096 CTACAGTCAGAACAATGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984334867 Original CRISPR GGATGAACACCCTTGGAACC TGG (reversed) Intergenic
No off target data available for this crispr