ID: 984339034

View in Genome Browser
Species Human (GRCh38)
Location 4:178430073-178430095
Sequence TCTTATTACTGGAGTCAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984339034_984339044 21 Left 984339034 4:178430073-178430095 CCTCCCTGACTCCAGTAATAAGA No data
Right 984339044 4:178430117-178430139 GAGAAGGGAGACGTTTTTCATGG No data
984339034_984339038 -8 Left 984339034 4:178430073-178430095 CCTCCCTGACTCCAGTAATAAGA No data
Right 984339038 4:178430088-178430110 TAATAAGAACATTTTTTGCCTGG No data
984339034_984339039 -2 Left 984339034 4:178430073-178430095 CCTCCCTGACTCCAGTAATAAGA No data
Right 984339039 4:178430094-178430116 GAACATTTTTTGCCTGGTGATGG No data
984339034_984339045 22 Left 984339034 4:178430073-178430095 CCTCCCTGACTCCAGTAATAAGA No data
Right 984339045 4:178430118-178430140 AGAAGGGAGACGTTTTTCATGGG No data
984339034_984339041 5 Left 984339034 4:178430073-178430095 CCTCCCTGACTCCAGTAATAAGA No data
Right 984339041 4:178430101-178430123 TTTTGCCTGGTGATGGGAGAAGG No data
984339034_984339040 -1 Left 984339034 4:178430073-178430095 CCTCCCTGACTCCAGTAATAAGA No data
Right 984339040 4:178430095-178430117 AACATTTTTTGCCTGGTGATGGG No data
984339034_984339042 6 Left 984339034 4:178430073-178430095 CCTCCCTGACTCCAGTAATAAGA No data
Right 984339042 4:178430102-178430124 TTTGCCTGGTGATGGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984339034 Original CRISPR TCTTATTACTGGAGTCAGGG AGG (reversed) Intergenic
No off target data available for this crispr