ID: 984340850

View in Genome Browser
Species Human (GRCh38)
Location 4:178454155-178454177
Sequence CATTAGGACAGGAGGTTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984340844_984340850 4 Left 984340844 4:178454128-178454150 CCAGGATGTCCATCTGGCTTCAC No data
Right 984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG No data
984340837_984340850 24 Left 984340837 4:178454108-178454130 CCAAGTCCCCACTCGATGACCCA No data
Right 984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG No data
984340843_984340850 5 Left 984340843 4:178454127-178454149 CCCAGGATGTCCATCTGGCTTCA No data
Right 984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG No data
984340840_984340850 17 Left 984340840 4:178454115-178454137 CCCACTCGATGACCCAGGATGTC No data
Right 984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG No data
984340845_984340850 -5 Left 984340845 4:178454137-178454159 CCATCTGGCTTCACCTCTCATTA No data
Right 984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG No data
984340841_984340850 16 Left 984340841 4:178454116-178454138 CCACTCGATGACCCAGGATGTCC No data
Right 984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG No data
984340839_984340850 18 Left 984340839 4:178454114-178454136 CCCCACTCGATGACCCAGGATGT No data
Right 984340850 4:178454155-178454177 CATTAGGACAGGAGGTTAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984340850 Original CRISPR CATTAGGACAGGAGGTTAGT TGG Intergenic
No off target data available for this crispr