ID: 984348281

View in Genome Browser
Species Human (GRCh38)
Location 4:178559623-178559645
Sequence TCTAGCTGGTCTTCAACTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984348281_984348286 27 Left 984348281 4:178559623-178559645 CCGGCAGTTGAAGACCAGCTAGA No data
Right 984348286 4:178559673-178559695 AAAAATTTTGAAAATTGGTCAGG No data
984348281_984348285 22 Left 984348281 4:178559623-178559645 CCGGCAGTTGAAGACCAGCTAGA No data
Right 984348285 4:178559668-178559690 CTACAAAAAATTTTGAAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984348281 Original CRISPR TCTAGCTGGTCTTCAACTGC CGG (reversed) Intergenic
No off target data available for this crispr