ID: 984363547

View in Genome Browser
Species Human (GRCh38)
Location 4:178769548-178769570
Sequence CTGAATTTATGGAGACCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984363547_984363549 5 Left 984363547 4:178769548-178769570 CCTTCTGGTCTCCATAAATTCAG No data
Right 984363549 4:178769576-178769598 AAGTCTTCTATCACTTGAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984363547 Original CRISPR CTGAATTTATGGAGACCAGA AGG (reversed) Intergenic
No off target data available for this crispr