ID: 984365393

View in Genome Browser
Species Human (GRCh38)
Location 4:178792990-178793012
Sequence GAGCAAAAAGCAGAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984365393_984365398 3 Left 984365393 4:178792990-178793012 CCCTCCACCTCTGCTTTTTGCTC No data
Right 984365398 4:178793016-178793038 CTCCTACCATGTGAGATGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984365393 Original CRISPR GAGCAAAAAGCAGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr