ID: 984366550

View in Genome Browser
Species Human (GRCh38)
Location 4:178806266-178806288
Sequence TTCTTGTTAGATTTCCAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984366550_984366556 8 Left 984366550 4:178806266-178806288 CCAAGCTGGAAATCTAACAAGAA No data
Right 984366556 4:178806297-178806319 CCCAGTCATGTTCTTGGTGAGGG No data
984366550_984366558 20 Left 984366550 4:178806266-178806288 CCAAGCTGGAAATCTAACAAGAA No data
Right 984366558 4:178806309-178806331 CTTGGTGAGGGCCCTCTTCCTGG 0: 13
1: 61
2: 347
3: 1001
4: 2040
984366550_984366553 2 Left 984366550 4:178806266-178806288 CCAAGCTGGAAATCTAACAAGAA No data
Right 984366553 4:178806291-178806313 TGGCAGCCCAGTCATGTTCTTGG No data
984366550_984366554 7 Left 984366550 4:178806266-178806288 CCAAGCTGGAAATCTAACAAGAA No data
Right 984366554 4:178806296-178806318 GCCCAGTCATGTTCTTGGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984366550 Original CRISPR TTCTTGTTAGATTTCCAGCT TGG (reversed) Intergenic
No off target data available for this crispr