ID: 984375589

View in Genome Browser
Species Human (GRCh38)
Location 4:178924610-178924632
Sequence CCTAGCACTGTCTAGTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984375589_984375595 10 Left 984375589 4:178924610-178924632 CCAGCCAACTAGACAGTGCTAGG No data
Right 984375595 4:178924643-178924665 GAGAAGAGCTTGGGAAAGCGAGG No data
984375589_984375593 0 Left 984375589 4:178924610-178924632 CCAGCCAACTAGACAGTGCTAGG No data
Right 984375593 4:178924633-178924655 AGGCAGCAGAGAGAAGAGCTTGG No data
984375589_984375594 1 Left 984375589 4:178924610-178924632 CCAGCCAACTAGACAGTGCTAGG No data
Right 984375594 4:178924634-178924656 GGCAGCAGAGAGAAGAGCTTGGG No data
984375589_984375596 29 Left 984375589 4:178924610-178924632 CCAGCCAACTAGACAGTGCTAGG No data
Right 984375596 4:178924662-178924684 GAGGCTGTTTATGAATTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984375589 Original CRISPR CCTAGCACTGTCTAGTTGGC TGG (reversed) Intergenic
No off target data available for this crispr