ID: 984385573

View in Genome Browser
Species Human (GRCh38)
Location 4:179052988-179053010
Sequence GGGTGGCTCAGTACAAATTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
984385573_984385580 17 Left 984385573 4:179052988-179053010 CCCTAATTTGTACTGAGCCACCC No data
Right 984385580 4:179053028-179053050 GTAGGATAACACTTTCACCATGG No data
984385573_984385581 24 Left 984385573 4:179052988-179053010 CCCTAATTTGTACTGAGCCACCC No data
Right 984385581 4:179053035-179053057 AACACTTTCACCATGGCCTTTGG No data
984385573_984385579 -1 Left 984385573 4:179052988-179053010 CCCTAATTTGTACTGAGCCACCC No data
Right 984385579 4:179053010-179053032 CAAATGGTTATTACAGCAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
984385573 Original CRISPR GGGTGGCTCAGTACAAATTA GGG (reversed) Intergenic
No off target data available for this crispr